ID: 1061274595

View in Genome Browser
Species Human (GRCh38)
Location 9:129562129-129562151
Sequence AGGCAGGGGTGAGGGGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061274582_1061274595 2 Left 1061274582 9:129562104-129562126 CCTGAACCCCAGCTGGGCAGTGG No data
Right 1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG No data
1061274586_1061274595 -4 Left 1061274586 9:129562110-129562132 CCCCAGCTGGGCAGTGGGAAGGC No data
Right 1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG No data
1061274578_1061274595 30 Left 1061274578 9:129562076-129562098 CCTGCGGGAAGCAGGAGGAAGCC No data
Right 1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG No data
1061274579_1061274595 9 Left 1061274579 9:129562097-129562119 CCATTTTCCTGAACCCCAGCTGG No data
Right 1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG No data
1061274587_1061274595 -5 Left 1061274587 9:129562111-129562133 CCCAGCTGGGCAGTGGGAAGGCA No data
Right 1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG No data
1061274588_1061274595 -6 Left 1061274588 9:129562112-129562134 CCAGCTGGGCAGTGGGAAGGCAG No data
Right 1061274595 9:129562129-129562151 AGGCAGGGGTGAGGGGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061274595 Original CRISPR AGGCAGGGGTGAGGGGCAGC TGG Intergenic
No off target data available for this crispr