ID: 1061275252

View in Genome Browser
Species Human (GRCh38)
Location 9:129566502-129566524
Sequence CAAGCTGGCCTGTTGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061275252_1061275260 18 Left 1061275252 9:129566502-129566524 CCCAGTCCCAACAGGCCAGCTTG No data
Right 1061275260 9:129566543-129566565 TGTCCCCTTGCAGCGAGCAAGGG No data
1061275252_1061275261 19 Left 1061275252 9:129566502-129566524 CCCAGTCCCAACAGGCCAGCTTG No data
Right 1061275261 9:129566544-129566566 GTCCCCTTGCAGCGAGCAAGGGG No data
1061275252_1061275265 29 Left 1061275252 9:129566502-129566524 CCCAGTCCCAACAGGCCAGCTTG No data
Right 1061275265 9:129566554-129566576 AGCGAGCAAGGGGAGTCCAGAGG No data
1061275252_1061275266 30 Left 1061275252 9:129566502-129566524 CCCAGTCCCAACAGGCCAGCTTG No data
Right 1061275266 9:129566555-129566577 GCGAGCAAGGGGAGTCCAGAGGG No data
1061275252_1061275259 17 Left 1061275252 9:129566502-129566524 CCCAGTCCCAACAGGCCAGCTTG No data
Right 1061275259 9:129566542-129566564 GTGTCCCCTTGCAGCGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061275252 Original CRISPR CAAGCTGGCCTGTTGGGACT GGG (reversed) Intergenic
No off target data available for this crispr