ID: 1061275881

View in Genome Browser
Species Human (GRCh38)
Location 9:129569183-129569205
Sequence TGAGCTCTGCCAAGGGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061275875_1061275881 -7 Left 1061275875 9:129569167-129569189 CCGGGTGGGCGCGGGCTGAGCTC No data
Right 1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG No data
1061275874_1061275881 -1 Left 1061275874 9:129569161-129569183 CCGGCTCCGGGTGGGCGCGGGCT No data
Right 1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG No data
1061275868_1061275881 5 Left 1061275868 9:129569155-129569177 CCCTCCCCGGCTCCGGGTGGGCG No data
Right 1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG No data
1061275869_1061275881 4 Left 1061275869 9:129569156-129569178 CCTCCCCGGCTCCGGGTGGGCGC No data
Right 1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG No data
1061275873_1061275881 0 Left 1061275873 9:129569160-129569182 CCCGGCTCCGGGTGGGCGCGGGC No data
Right 1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG No data
1061275871_1061275881 1 Left 1061275871 9:129569159-129569181 CCCCGGCTCCGGGTGGGCGCGGG No data
Right 1061275881 9:129569183-129569205 TGAGCTCTGCCAAGGGCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061275881 Original CRISPR TGAGCTCTGCCAAGGGCCGG GGG Intergenic
No off target data available for this crispr