ID: 1061280087

View in Genome Browser
Species Human (GRCh38)
Location 9:129592994-129593016
Sequence GGTTGAAGAGAGTCCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061280084_1061280087 23 Left 1061280084 9:129592948-129592970 CCAACTTTTATAGATAAGATCTA No data
Right 1061280087 9:129592994-129593016 GGTTGAAGAGAGTCCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061280087 Original CRISPR GGTTGAAGAGAGTCCCCTGT GGG Intergenic
No off target data available for this crispr