ID: 1061280106

View in Genome Browser
Species Human (GRCh38)
Location 9:129593081-129593103
Sequence GGGTTAAGGAGACCCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061280097_1061280106 28 Left 1061280097 9:129593030-129593052 CCTAAAGCTCCGTTTTGGGAGCT No data
Right 1061280106 9:129593081-129593103 GGGTTAAGGAGACCCAAAGCAGG No data
1061280098_1061280106 19 Left 1061280098 9:129593039-129593061 CCGTTTTGGGAGCTGTGTAAGTA No data
Right 1061280106 9:129593081-129593103 GGGTTAAGGAGACCCAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061280106 Original CRISPR GGGTTAAGGAGACCCAAAGC AGG Intergenic
No off target data available for this crispr