ID: 1061280150

View in Genome Browser
Species Human (GRCh38)
Location 9:129593362-129593384
Sequence GCCCAGGTATGAAACCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061280146_1061280150 1 Left 1061280146 9:129593338-129593360 CCAGGTGGCAGGGGTAATCATGA No data
Right 1061280150 9:129593362-129593384 GCCCAGGTATGAAACCTTGGAGG No data
1061280139_1061280150 29 Left 1061280139 9:129593310-129593332 CCATCTGCTTGTGTGTTGAGGGA No data
Right 1061280150 9:129593362-129593384 GCCCAGGTATGAAACCTTGGAGG No data
1061280145_1061280150 2 Left 1061280145 9:129593337-129593359 CCCAGGTGGCAGGGGTAATCATG No data
Right 1061280150 9:129593362-129593384 GCCCAGGTATGAAACCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061280150 Original CRISPR GCCCAGGTATGAAACCTTGG AGG Intergenic
No off target data available for this crispr