ID: 1061281621

View in Genome Browser
Species Human (GRCh38)
Location 9:129600981-129601003
Sequence CCTGAATGAACGCTGCGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061281621_1061281628 7 Left 1061281621 9:129600981-129601003 CCTTTGCGCAGCGTTCATTCAGG No data
Right 1061281628 9:129601011-129601033 CTGTGGCAGGCTCTGTGTTAGGG No data
1061281621_1061281624 -10 Left 1061281621 9:129600981-129601003 CCTTTGCGCAGCGTTCATTCAGG No data
Right 1061281624 9:129600994-129601016 TTCATTCAGGGCCTTCTCTGTGG No data
1061281621_1061281625 -6 Left 1061281621 9:129600981-129601003 CCTTTGCGCAGCGTTCATTCAGG No data
Right 1061281625 9:129600998-129601020 TTCAGGGCCTTCTCTGTGGCAGG No data
1061281621_1061281627 6 Left 1061281621 9:129600981-129601003 CCTTTGCGCAGCGTTCATTCAGG No data
Right 1061281627 9:129601010-129601032 TCTGTGGCAGGCTCTGTGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061281621 Original CRISPR CCTGAATGAACGCTGCGCAA AGG (reversed) Intergenic
No off target data available for this crispr