ID: 1061281625

View in Genome Browser
Species Human (GRCh38)
Location 9:129600998-129601020
Sequence TTCAGGGCCTTCTCTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061281620_1061281625 -5 Left 1061281620 9:129600980-129601002 CCCTTTGCGCAGCGTTCATTCAG No data
Right 1061281625 9:129600998-129601020 TTCAGGGCCTTCTCTGTGGCAGG No data
1061281617_1061281625 1 Left 1061281617 9:129600974-129600996 CCCCATCCCTTTGCGCAGCGTTC No data
Right 1061281625 9:129600998-129601020 TTCAGGGCCTTCTCTGTGGCAGG No data
1061281618_1061281625 0 Left 1061281618 9:129600975-129600997 CCCATCCCTTTGCGCAGCGTTCA No data
Right 1061281625 9:129600998-129601020 TTCAGGGCCTTCTCTGTGGCAGG No data
1061281619_1061281625 -1 Left 1061281619 9:129600976-129600998 CCATCCCTTTGCGCAGCGTTCAT No data
Right 1061281625 9:129600998-129601020 TTCAGGGCCTTCTCTGTGGCAGG No data
1061281621_1061281625 -6 Left 1061281621 9:129600981-129601003 CCTTTGCGCAGCGTTCATTCAGG No data
Right 1061281625 9:129600998-129601020 TTCAGGGCCTTCTCTGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061281625 Original CRISPR TTCAGGGCCTTCTCTGTGGC AGG Intergenic
No off target data available for this crispr