ID: 1061282977

View in Genome Browser
Species Human (GRCh38)
Location 9:129608029-129608051
Sequence ACCCGGAGGAGGGCCCTCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061282977_1061282986 13 Left 1061282977 9:129608029-129608051 CCCGTGAGGGCCCTCCTCCGGGT No data
Right 1061282986 9:129608065-129608087 CCTCTTGCGGTATCCGCACAAGG No data
1061282977_1061282990 22 Left 1061282977 9:129608029-129608051 CCCGTGAGGGCCCTCCTCCGGGT No data
Right 1061282990 9:129608074-129608096 GTATCCGCACAAGGAGGAAGGGG No data
1061282977_1061282981 -10 Left 1061282977 9:129608029-129608051 CCCGTGAGGGCCCTCCTCCGGGT No data
Right 1061282981 9:129608042-129608064 TCCTCCGGGTTGCACACTGCTGG No data
1061282977_1061282987 16 Left 1061282977 9:129608029-129608051 CCCGTGAGGGCCCTCCTCCGGGT No data
Right 1061282987 9:129608068-129608090 CTTGCGGTATCCGCACAAGGAGG No data
1061282977_1061282984 0 Left 1061282977 9:129608029-129608051 CCCGTGAGGGCCCTCCTCCGGGT No data
Right 1061282984 9:129608052-129608074 TGCACACTGCTGGCCTCTTGCGG No data
1061282977_1061282989 21 Left 1061282977 9:129608029-129608051 CCCGTGAGGGCCCTCCTCCGGGT No data
Right 1061282989 9:129608073-129608095 GGTATCCGCACAAGGAGGAAGGG No data
1061282977_1061282992 27 Left 1061282977 9:129608029-129608051 CCCGTGAGGGCCCTCCTCCGGGT No data
Right 1061282992 9:129608079-129608101 CGCACAAGGAGGAAGGGGCAAGG No data
1061282977_1061282988 20 Left 1061282977 9:129608029-129608051 CCCGTGAGGGCCCTCCTCCGGGT No data
Right 1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061282977 Original CRISPR ACCCGGAGGAGGGCCCTCAC GGG (reversed) Intergenic
No off target data available for this crispr