ID: 1061282978

View in Genome Browser
Species Human (GRCh38)
Location 9:129608030-129608052
Sequence AACCCGGAGGAGGGCCCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061282978_1061282986 12 Left 1061282978 9:129608030-129608052 CCGTGAGGGCCCTCCTCCGGGTT No data
Right 1061282986 9:129608065-129608087 CCTCTTGCGGTATCCGCACAAGG No data
1061282978_1061282992 26 Left 1061282978 9:129608030-129608052 CCGTGAGGGCCCTCCTCCGGGTT No data
Right 1061282992 9:129608079-129608101 CGCACAAGGAGGAAGGGGCAAGG No data
1061282978_1061282987 15 Left 1061282978 9:129608030-129608052 CCGTGAGGGCCCTCCTCCGGGTT No data
Right 1061282987 9:129608068-129608090 CTTGCGGTATCCGCACAAGGAGG No data
1061282978_1061282990 21 Left 1061282978 9:129608030-129608052 CCGTGAGGGCCCTCCTCCGGGTT No data
Right 1061282990 9:129608074-129608096 GTATCCGCACAAGGAGGAAGGGG No data
1061282978_1061282984 -1 Left 1061282978 9:129608030-129608052 CCGTGAGGGCCCTCCTCCGGGTT No data
Right 1061282984 9:129608052-129608074 TGCACACTGCTGGCCTCTTGCGG No data
1061282978_1061282989 20 Left 1061282978 9:129608030-129608052 CCGTGAGGGCCCTCCTCCGGGTT No data
Right 1061282989 9:129608073-129608095 GGTATCCGCACAAGGAGGAAGGG No data
1061282978_1061282988 19 Left 1061282978 9:129608030-129608052 CCGTGAGGGCCCTCCTCCGGGTT No data
Right 1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061282978 Original CRISPR AACCCGGAGGAGGGCCCTCA CGG (reversed) Intergenic
No off target data available for this crispr