ID: 1061282980

View in Genome Browser
Species Human (GRCh38)
Location 9:129608040-129608062
Sequence AGCAGTGTGCAACCCGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061282980_1061282987 5 Left 1061282980 9:129608040-129608062 CCTCCTCCGGGTTGCACACTGCT No data
Right 1061282987 9:129608068-129608090 CTTGCGGTATCCGCACAAGGAGG No data
1061282980_1061282989 10 Left 1061282980 9:129608040-129608062 CCTCCTCCGGGTTGCACACTGCT No data
Right 1061282989 9:129608073-129608095 GGTATCCGCACAAGGAGGAAGGG No data
1061282980_1061282994 26 Left 1061282980 9:129608040-129608062 CCTCCTCCGGGTTGCACACTGCT No data
Right 1061282994 9:129608089-129608111 GGAAGGGGCAAGGCCTTTCTGGG No data
1061282980_1061282992 16 Left 1061282980 9:129608040-129608062 CCTCCTCCGGGTTGCACACTGCT No data
Right 1061282992 9:129608079-129608101 CGCACAAGGAGGAAGGGGCAAGG No data
1061282980_1061282990 11 Left 1061282980 9:129608040-129608062 CCTCCTCCGGGTTGCACACTGCT No data
Right 1061282990 9:129608074-129608096 GTATCCGCACAAGGAGGAAGGGG No data
1061282980_1061282988 9 Left 1061282980 9:129608040-129608062 CCTCCTCCGGGTTGCACACTGCT No data
Right 1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG No data
1061282980_1061282986 2 Left 1061282980 9:129608040-129608062 CCTCCTCCGGGTTGCACACTGCT No data
Right 1061282986 9:129608065-129608087 CCTCTTGCGGTATCCGCACAAGG No data
1061282980_1061282993 25 Left 1061282980 9:129608040-129608062 CCTCCTCCGGGTTGCACACTGCT No data
Right 1061282993 9:129608088-129608110 AGGAAGGGGCAAGGCCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061282980 Original CRISPR AGCAGTGTGCAACCCGGAGG AGG (reversed) Intergenic
No off target data available for this crispr