ID: 1061282988

View in Genome Browser
Species Human (GRCh38)
Location 9:129608072-129608094
Sequence CGGTATCCGCACAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061282977_1061282988 20 Left 1061282977 9:129608029-129608051 CCCGTGAGGGCCCTCCTCCGGGT No data
Right 1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG No data
1061282980_1061282988 9 Left 1061282980 9:129608040-129608062 CCTCCTCCGGGTTGCACACTGCT No data
Right 1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG No data
1061282983_1061282988 3 Left 1061282983 9:129608046-129608068 CCGGGTTGCACACTGCTGGCCTC No data
Right 1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG No data
1061282979_1061282988 10 Left 1061282979 9:129608039-129608061 CCCTCCTCCGGGTTGCACACTGC No data
Right 1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG No data
1061282982_1061282988 6 Left 1061282982 9:129608043-129608065 CCTCCGGGTTGCACACTGCTGGC No data
Right 1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG No data
1061282978_1061282988 19 Left 1061282978 9:129608030-129608052 CCGTGAGGGCCCTCCTCCGGGTT No data
Right 1061282988 9:129608072-129608094 CGGTATCCGCACAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061282988 Original CRISPR CGGTATCCGCACAAGGAGGA AGG Intergenic
No off target data available for this crispr