ID: 1061283701

View in Genome Browser
Species Human (GRCh38)
Location 9:129610814-129610836
Sequence TCTACGGCCCCTCCTCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 141}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061283701_1061283708 -1 Left 1061283701 9:129610814-129610836 CCACCTGGAGGAGGGGCCGTAGA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1061283708 9:129610836-129610858 AATCAGGCCTGCTGAGACGGGGG No data
1061283701_1061283705 -4 Left 1061283701 9:129610814-129610836 CCACCTGGAGGAGGGGCCGTAGA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1061283705 9:129610833-129610855 TAGAATCAGGCCTGCTGAGACGG No data
1061283701_1061283709 3 Left 1061283701 9:129610814-129610836 CCACCTGGAGGAGGGGCCGTAGA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1061283709 9:129610840-129610862 AGGCCTGCTGAGACGGGGGACGG No data
1061283701_1061283714 24 Left 1061283701 9:129610814-129610836 CCACCTGGAGGAGGGGCCGTAGA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1061283714 9:129610861-129610883 GGGGCGTGAATGTCCAGAAAGGG No data
1061283701_1061283710 4 Left 1061283701 9:129610814-129610836 CCACCTGGAGGAGGGGCCGTAGA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1061283710 9:129610841-129610863 GGCCTGCTGAGACGGGGGACGGG No data
1061283701_1061283713 23 Left 1061283701 9:129610814-129610836 CCACCTGGAGGAGGGGCCGTAGA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1061283713 9:129610860-129610882 CGGGGCGTGAATGTCCAGAAAGG No data
1061283701_1061283706 -3 Left 1061283701 9:129610814-129610836 CCACCTGGAGGAGGGGCCGTAGA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1061283706 9:129610834-129610856 AGAATCAGGCCTGCTGAGACGGG No data
1061283701_1061283707 -2 Left 1061283701 9:129610814-129610836 CCACCTGGAGGAGGGGCCGTAGA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1061283707 9:129610835-129610857 GAATCAGGCCTGCTGAGACGGGG No data
1061283701_1061283711 5 Left 1061283701 9:129610814-129610836 CCACCTGGAGGAGGGGCCGTAGA 0: 1
1: 0
2: 0
3: 18
4: 141
Right 1061283711 9:129610842-129610864 GCCTGCTGAGACGGGGGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061283701 Original CRISPR TCTACGGCCCCTCCTCCAGG TGG (reversed) Intronic
901130586 1:6960425-6960447 CCGACTGCCCCTCCTCCCGGTGG + Intronic
902449983 1:16490866-16490888 TCTGCGGCTCCTCCTCCAGCCGG + Intergenic
902504479 1:16930324-16930346 TCTGCTGCTCCTCCTCCAGCCGG - Exonic
904617980 1:31760303-31760325 ACCAAGGCCCCTCCTCTAGGGGG + Intronic
905259893 1:36709761-36709783 TCTCAGACTCCTCCTCCAGGAGG - Intergenic
905990625 1:42334771-42334793 TCTCCCGCCCCTCCCCCAGGCGG - Intronic
907075716 1:51576274-51576296 TCTGAGGCCCCTCCCTCAGGAGG - Intergenic
907305452 1:53510457-53510479 TCCAGGGCTCCTCGTCCAGGTGG - Intronic
909413394 1:75379064-75379086 TCTTGGGCTCCTTCTCCAGGTGG - Intronic
910155530 1:84214194-84214216 TCTACGGAACCTGCTGCAGGTGG + Exonic
915402493 1:155633845-155633867 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
916009603 1:160692753-160692775 TCTTGGGCTCCTTCTCCAGGTGG - Intronic
922235716 1:223721215-223721237 TCTCCAGCCCTTCCTCCAGAAGG - Intronic
1063531046 10:6831647-6831669 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1070257929 10:74826698-74826720 GCGACGGCACCTCCTCCAGGCGG + Exonic
1070772683 10:79091584-79091606 TAAATGCCCCCTCCTCCAGGAGG - Intronic
1072947888 10:99826926-99826948 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1073070634 10:100791088-100791110 CCTGTGGCCCATCCTCCAGGTGG + Intronic
1074125911 10:110528654-110528676 TCTAAAGCCCCTCATCCAGGGGG - Intergenic
1074400926 10:113140792-113140814 CCCAAGGCCCCACCTCCAGGAGG - Intronic
1076814837 10:132909602-132909624 TCCAAGGCCCCTCCTCCATCTGG + Intronic
1081684532 11:45032919-45032941 TAAATGCCCCCTCCTCCAGGAGG + Intergenic
1082820866 11:57543795-57543817 TCTTGCGCCCCTCCCCCAGGTGG - Intronic
1083394511 11:62380818-62380840 TCTTGGGCCCCTTCTCCAGGTGG + Intronic
1084165729 11:67373886-67373908 TCCCCGCCCCCTCCCCCAGGAGG - Intronic
1084479268 11:69409239-69409261 TCTCCTGCCCCTCCACAAGGTGG - Intergenic
1085051859 11:73384076-73384098 CCTACCTGCCCTCCTCCAGGTGG + Intronic
1085896941 11:80651174-80651196 GCTAAGGCCACTCCTCCTGGTGG + Intergenic
1086983029 11:93219335-93219357 TCTATGACCCCTCTCCCAGGTGG + Intergenic
1087723936 11:101697041-101697063 TCTTGGGCTCCTTCTCCAGGTGG - Intronic
1089556331 11:119317494-119317516 GCTACTGCTCCTCCCCCAGGAGG - Intronic
1091226995 11:133963457-133963479 TCTACGGTCCCTTTTCCAGATGG - Intergenic
1091267522 11:134282434-134282456 GCTACAGCCCCTCCTGCATGGGG - Intronic
1097331245 12:58334915-58334937 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1098336799 12:69412850-69412872 TCAATGTCACCTCCTCCAGGTGG - Intergenic
1101963184 12:109265154-109265176 TCTGCGCCGCCTCCTCCTGGAGG + Exonic
1104257606 12:127154034-127154056 TCTACGGGACCTCCTCCATCAGG + Intergenic
1104931003 12:132339436-132339458 TCTGCGGCCCCTCGGCCATGTGG + Intergenic
1105415954 13:20211453-20211475 ACCACTGCCCCTCCCCCAGGTGG + Intergenic
1108722300 13:53144902-53144924 TGGACGGCCCCTCCTCATGGAGG - Intergenic
1115900385 14:38140741-38140763 TCTACTGCCCCTTCTTCAGCAGG + Intergenic
1121067175 14:90979181-90979203 TGTGGTGCCCCTCCTCCAGGTGG + Intronic
1122066338 14:99176364-99176386 TCTTCGGCCCCCCAGCCAGGAGG - Intronic
1123047744 14:105526915-105526937 CCTCCCGCCCCTCCTCCCGGGGG + Intronic
1124781601 15:32641648-32641670 GCCCCGGCCCCTCCTCCAGCAGG - Intergenic
1127674558 15:61227773-61227795 TCTCCGTCCCCAGCTCCAGGCGG + Intronic
1132229494 15:100171136-100171158 ACTGCAGCCCCTCCTGCAGGTGG - Intronic
1132599234 16:766649-766671 TCGGCGGCCCCTCCCACAGGTGG + Exonic
1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG + Intergenic
1140043059 16:71422209-71422231 TTTCTGGCCCTTCCTCCAGGGGG - Intergenic
1141797795 16:86286625-86286647 CCTGCGGCCCCTCCTCCCGCTGG - Intergenic
1141995520 16:87634514-87634536 TCTGCGTCCCTGCCTCCAGGTGG + Intronic
1143112338 17:4559611-4559633 TCTGTGGCCCCTCCACCCGGCGG - Exonic
1144065066 17:11617508-11617530 GCTGCGGCCCCTGCTCCACGTGG + Exonic
1144837364 17:18163723-18163745 TCTTCCGCCCCACCCCCAGGTGG + Exonic
1148155081 17:45418979-45419001 TCTAGGGCCCCCCCACCAAGTGG + Intronic
1148736890 17:49870006-49870028 TCTAAGGTCCCTCCTGGAGGGGG + Intergenic
1149616575 17:58006368-58006390 GCTATGGCCCCCCATCCAGGCGG - Exonic
1150386781 17:64767715-64767737 TCTAGGGCCACCCCTCCAAGTGG + Intergenic
1153171931 18:2326735-2326757 TCTCCAGCTCCTCATCCAGGGGG + Intergenic
1156365950 18:36427387-36427409 TCTCAGGCCACTCCTACAGGCGG + Intronic
1160231702 18:77053978-77054000 TCTTGGCCCCCTCCTCGAGGTGG + Intronic
1161250016 19:3275550-3275572 TCCACTGCTCCCCCTCCAGGCGG - Intronic
1161587099 19:5111427-5111449 GCTTTGGCCTCTCCTCCAGGCGG - Intronic
1162016201 19:7847834-7847856 TCCACGTGTCCTCCTCCAGGTGG - Exonic
1162387140 19:10366424-10366446 TCTTGGCCACCTCCTCCAGGGGG + Exonic
1162476812 19:10905308-10905330 TCTATGTCCCCACCTCCAAGAGG + Intronic
1163919900 19:20278659-20278681 TCTTGGGCCCCTTCTTCAGGTGG - Intergenic
1164153888 19:22576902-22576924 TCTTGGGCTCCTTCTCCAGGTGG - Intergenic
1164371142 19:27645421-27645443 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1164637047 19:29799272-29799294 TCGACGTCCCCTCCTGGAGGAGG - Intergenic
1165088058 19:33364959-33364981 TCTACAGGAGCTCCTCCAGGAGG - Intergenic
1165798414 19:38532676-38532698 TCTCCCCTCCCTCCTCCAGGTGG - Exonic
1166565814 19:43764947-43764969 AATATGTCCCCTCCTCCAGGAGG - Intergenic
1166790648 19:45396674-45396696 CCTGGGGCCCCTCCGCCAGGGGG + Exonic
1168146111 19:54420792-54420814 TCTCCGCCCCCACCTCCTGGGGG - Intronic
927883833 2:26706597-26706619 TCTCCGGCCCCTCCTGGAGGTGG - Intronic
934853710 2:97716538-97716560 CCTAAGTCACCTCCTCCAGGAGG - Intronic
939610303 2:144301802-144301824 GCCACTGCCACTCCTCCAGGAGG + Intronic
940826259 2:158416099-158416121 TCTCAGGCCACTCCTCCAGAGGG - Intronic
946372709 2:219290415-219290437 GCTTCTGCGCCTCCTCCAGGAGG - Intronic
1176414047 21:6464794-6464816 TCTGCTGCCCCTCCTCTGGGGGG + Intergenic
1177171684 21:17662339-17662361 TCCAAGGCCCTTCTTCCAGGGGG - Intergenic
1177248934 21:18567808-18567830 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1177250379 21:18584000-18584022 TCTGCTTCCCCTGCTCCAGGCGG - Intergenic
1178672367 21:34603278-34603300 TCTCCGGCCCCTCCACAAGCTGG + Intronic
1179624303 21:42639820-42639842 TCCACAGCACCTCCTCGAGGGGG - Intergenic
1179689545 21:43073116-43073138 TCTGCTGCCCCTCCTCTGGGGGG + Intronic
1180837944 22:18940652-18940674 TCTTGGGCTCCTTCTCCAGGTGG - Intergenic
1181755372 22:25020691-25020713 TCAATGCCACCTCCTCCAGGAGG - Intronic
1181856075 22:25782466-25782488 TTTAGGCCACCTCCTCCAGGAGG - Intronic
1183310561 22:37107330-37107352 TCCACTGCCCCTCCTCCTGCTGG - Intronic
1183716438 22:39535959-39535981 CCTACGGTCCCCTCTCCAGGGGG - Intergenic
1184787459 22:46678783-46678805 TCTGCGGCCCCTCGTGAAGGGGG - Exonic
1185039748 22:48497930-48497952 TCTTCAGCCCCGCCTCCAGGTGG - Intronic
1185039762 22:48497965-48497987 TCTTCAGCCCCGCCTCCAGGTGG - Intronic
1185039776 22:48498000-48498022 TCTTCAGCCCCGCCTCCAGGTGG - Intronic
1185039825 22:48498137-48498159 TCTTCAGCCCCGCCTCCAGGTGG - Intronic
1185039874 22:48498274-48498296 TCTTCAGCCCCGCCTCCAGGTGG - Intronic
1185197265 22:49479731-49479753 TCCAGGGCCCCCGCTCCAGGAGG + Intronic
949883759 3:8679378-8679400 TCTCAGTCCCCTCCTCCTGGGGG - Intronic
950030886 3:9852602-9852624 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
951611263 3:24494885-24494907 CCTCCGCCCCCTCCTCCCGGCGG + Intronic
957472537 3:80678046-80678068 TCCTCGGCCTCTCATCCAGGTGG + Intergenic
959191022 3:103111969-103111991 TCTGCGCCCTCTCCTCCAGATGG + Intergenic
960028134 3:113031443-113031465 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
962820687 3:139044943-139044965 TCTAGGGCGGGTCCTCCAGGGGG - Intronic
963695998 3:148566577-148566599 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
963894196 3:150667737-150667759 TCTACTGTCTCTCCTCAAGGTGG - Intronic
967026567 3:185569731-185569753 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
968161467 3:196431420-196431442 TTTAGGGCCTTTCCTCCAGGCGG + Intronic
968731560 4:2271581-2271603 CCTGCAGCCCCTCCCCCAGGAGG + Intronic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
975683653 4:76898643-76898665 TCTCCGGCGCCCCCTCCAAGGGG + Intergenic
979087192 4:116428255-116428277 TCTCAGGCCACTCCTCCAGAAGG + Intergenic
982876789 4:160660597-160660619 TCTTGGGCTCCTTCTCCAGGTGG - Intergenic
983215378 4:164997661-164997683 TCTTGGGCCCCTTCTCCAGGTGG - Intergenic
988380702 5:30494115-30494137 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
989285400 5:39693199-39693221 TCTTTAGCCCCTCCTCCAGTAGG + Intergenic
989837136 5:46007205-46007227 TCTTGGGCCCCTTCTCCAGGTGG + Intergenic
999952400 5:156664885-156664907 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1001470536 5:172008954-172008976 TCTAGGGCCTCTCCTCCCTGTGG + Intergenic
1002760229 6:196207-196229 TCTCAGGCCTCTCCTCCAGAAGG - Intergenic
1003145448 6:3506359-3506381 CCTAGGGCCACCCCTCCAGGCGG - Intergenic
1005729640 6:28684507-28684529 TCTTGGGCCCCTTCTCCAGGTGG - Intergenic
1005898190 6:30195951-30195973 TCAAAGCCCCCTCCTCTAGGAGG + Intronic
1010592186 6:77724374-77724396 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1018887415 6:167951647-167951669 TCTCCCGCTCCTCCTCCAGGCGG - Exonic
1019403822 7:872060-872082 TCTGTGGCCCCTCCTCCTGCTGG + Intronic
1019656082 7:2196832-2196854 TCCACGGCTCCTACTCCATGAGG + Intronic
1019976860 7:4589897-4589919 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1019977795 7:4598400-4598422 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1024647776 7:51383936-51383958 CCTACGGCCCCTACCCCTGGGGG + Intergenic
1026499807 7:70934905-70934927 TCCACACCTCCTCCTCCAGGAGG + Intergenic
1026681146 7:72467458-72467480 TCTCCGGCTCCTCCTCCACCTGG - Intergenic
1027669237 7:81075400-81075422 TCTCTGGCTCCTCTTCCAGGTGG + Intergenic
1029967144 7:104751790-104751812 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1030176558 7:106660582-106660604 TCTACGGCTACTCCTCCTGCCGG - Exonic
1032497471 7:132373498-132373520 TCTACAGCCCTTAGTCCAGGAGG - Intronic
1033482386 7:141754984-141755006 TCTTGGGCCCCTTCTCCAGGTGG + Intronic
1035817354 8:2555681-2555703 TCAACTGCCCTTCCTCAAGGAGG + Intergenic
1036163190 8:6407203-6407225 TCAACTGCCGCTCCTCCAGGTGG - Intronic
1036292403 8:7505345-7505367 TCTTGGGCTCCTTCTCCAGGTGG + Intronic
1036648044 8:10624462-10624484 TCTGCATCACCTCCTCCAGGAGG - Intronic
1039727354 8:40233146-40233168 TCTGTGGCCCCACCTCAAGGTGG + Intergenic
1047432675 8:124806371-124806393 TTTCCGGCCCCTGCCCCAGGGGG + Intergenic
1048947368 8:139461961-139461983 TCTTGGGCTCCTTCTCCAGGTGG + Intergenic
1052695422 9:31871441-31871463 ACTATAGCCCCTTCTCCAGGAGG + Intergenic
1053284048 9:36839171-36839193 TCTCCTGCCCCTCCCTCAGGAGG + Exonic
1053737114 9:41108654-41108676 TCTCAGTCCCCTCCTCCCGGGGG - Intergenic
1054691234 9:68322663-68322685 TCTCAGTCCCCTCCTCCCGGGGG + Intergenic
1056977977 9:91278005-91278027 TCTACGATGCCTCCTCCAGTGGG - Intronic
1059424057 9:114209824-114209846 TCAAGTGCACCTCCTCCAGGAGG - Intronic
1059584903 9:115595705-115595727 TCTACTTCTCCTCTTCCAGGTGG - Intergenic
1060818987 9:126650897-126650919 TTTATGGCCCCTCCTCCCCGGGG + Intronic
1061283701 9:129610814-129610836 TCTACGGCCCCTCCTCCAGGTGG - Intronic
1061398406 9:130355604-130355626 TCAGTGGCCCTTCCTCCAGGAGG - Intronic
1061596735 9:131635492-131635514 TCCAACGCCCCTCCTCCAAGTGG + Intronic
1062487587 9:136787695-136787717 TCTTGGGCCCCTCTTCCAGGTGG + Intergenic
1198474710 X:136984014-136984036 TCTCCTGCCCCTCCTCCTCGAGG - Intergenic