ID: 1061284294

View in Genome Browser
Species Human (GRCh38)
Location 9:129613437-129613459
Sequence GCCAGCGCAGTCCCAACACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061284289_1061284294 -1 Left 1061284289 9:129613415-129613437 CCGCTTCCCTGGAGCCTCACAGG 0: 1
1: 0
2: 12
3: 93
4: 538
Right 1061284294 9:129613437-129613459 GCCAGCGCAGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 70
1061284284_1061284294 23 Left 1061284284 9:129613391-129613413 CCTGGCAATGTCCACGAGTCCCA 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1061284294 9:129613437-129613459 GCCAGCGCAGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 70
1061284288_1061284294 3 Left 1061284288 9:129613411-129613433 CCATCCGCTTCCCTGGAGCCTCA 0: 1
1: 0
2: 1
3: 43
4: 335
Right 1061284294 9:129613437-129613459 GCCAGCGCAGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 70
1061284287_1061284294 4 Left 1061284287 9:129613410-129613432 CCCATCCGCTTCCCTGGAGCCTC 0: 1
1: 0
2: 1
3: 26
4: 217
Right 1061284294 9:129613437-129613459 GCCAGCGCAGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 70
1061284291_1061284294 -7 Left 1061284291 9:129613421-129613443 CCCTGGAGCCTCACAGGCCAGCG 0: 1
1: 0
2: 0
3: 17
4: 185
Right 1061284294 9:129613437-129613459 GCCAGCGCAGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 70
1061284283_1061284294 24 Left 1061284283 9:129613390-129613412 CCCTGGCAATGTCCACGAGTCCC 0: 1
1: 0
2: 0
3: 12
4: 107
Right 1061284294 9:129613437-129613459 GCCAGCGCAGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 70
1061284285_1061284294 12 Left 1061284285 9:129613402-129613424 CCACGAGTCCCATCCGCTTCCCT 0: 1
1: 0
2: 1
3: 5
4: 199
Right 1061284294 9:129613437-129613459 GCCAGCGCAGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 70
1061284292_1061284294 -8 Left 1061284292 9:129613422-129613444 CCTGGAGCCTCACAGGCCAGCGC 0: 1
1: 0
2: 1
3: 27
4: 293
Right 1061284294 9:129613437-129613459 GCCAGCGCAGTCCCAACACGAGG 0: 1
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061284294 Original CRISPR GCCAGCGCAGTCCCAACACG AGG Exonic
903840478 1:26235162-26235184 ACCAGTACATTCCCAACACGTGG + Intronic
1065528713 10:26647794-26647816 GCTAGCGCAGTGCCACCCCGTGG + Intergenic
1070562550 10:77578779-77578801 GCCAGGGCACTCCCAAGACATGG + Intronic
1072710717 10:97714137-97714159 GCCAGCGCGAGCCCAGCACGGGG - Exonic
1073653382 10:105385716-105385738 GCCAGCACAGGCCCCAGACGAGG + Intergenic
1074943753 10:118260404-118260426 GCCAAAGCAGTCCCAACTAGTGG + Intergenic
1077323365 11:1952445-1952467 GCCACTGCAGTCCCACCTCGGGG - Intronic
1077915148 11:6606803-6606825 GCCAGGGCAGGCCAAACTCGGGG - Intronic
1078256511 11:9663669-9663691 GATAGCGCAGTCCCAAGTCGGGG - Intergenic
1081856251 11:46305534-46305556 GCCAGTCTAGTCCCCACACGAGG + Intronic
1084735771 11:71104339-71104361 GCCTCTGCAGTCCCAACACAGGG + Intronic
1202806353 11_KI270721v1_random:7640-7662 GCCACTGCAGTCCCACCTCGGGG - Intergenic
1092107551 12:5933059-5933081 GCCTGCGGAGTCCCCACAAGGGG + Intronic
1092294921 12:7189954-7189976 CCCCGCGCAGCCCCAGCACGCGG - Intronic
1092796764 12:12118826-12118848 GCCATCGCAGTGCAAGCACGTGG + Exonic
1093719303 12:22420199-22420221 GCCAGCCCAAACTCAACACGTGG + Intronic
1093719802 12:22426839-22426861 GCCAGCCCAAACTCAACACGTGG + Intronic
1102968171 12:117144819-117144841 GCCAGTGCCGTCCGAACACACGG + Intronic
1105292382 13:19061270-19061292 CCCAGCGCAGCCTCAACACGCGG - Intergenic
1109429382 13:62212359-62212381 GCCAGGGCAGTCCCACCGCCAGG + Intergenic
1114298231 14:21349861-21349883 GACAGCGCAGTCCCAACTAAAGG - Intronic
1118887828 14:69881022-69881044 GCAAGGGCTGGCCCAACACGGGG - Intronic
1122132699 14:99614329-99614351 CCCAGCTCAGCCCCAACACCAGG + Intergenic
1122541507 14:102500254-102500276 GCCAGCCCAGCCCCACCACAGGG + Exonic
1125766947 15:42142405-42142427 GCCAGCTCAGGCCCACCAGGAGG + Intronic
1127166449 15:56248883-56248905 GCCAGTGCAGTCTGAACAGGTGG + Intronic
1128875966 15:71201636-71201658 GCTAGCTCAGTCCCAAGGCGTGG + Intronic
1134552878 16:15146130-15146152 GCCAGCGCATCACCCACACGTGG + Intergenic
1139510396 16:67424927-67424949 CCCAGCCCACTCCCAACACAAGG + Intergenic
1141169969 16:81684960-81684982 GCCAGGGCAGTCCCGAGGCGGGG + Intronic
1144546073 17:16197085-16197107 GCCAGCGCAGGCAGATCACGAGG + Intronic
1147145468 17:38482161-38482183 GCCAGAGCAGGCCCAGCAGGGGG + Intronic
1161035588 19:2082674-2082696 GCCAGCGCTGCTCCACCACGGGG + Intronic
1161390035 19:4015973-4015995 GCCAGCCCCGTCCCCACACACGG - Intronic
1163555284 19:17988643-17988665 GCCAGCACAGTCTTGACACGGGG - Intronic
1164832754 19:31335232-31335254 GCCAACGCAGTTCCAAAATGTGG - Intronic
1167499815 19:49839186-49839208 GCCAAGGCAGGCCCAACACTGGG + Intergenic
926208025 2:10847779-10847801 GCCAGCGGAGTCCCCCCACGAGG + Intronic
930750250 2:54927602-54927624 GCCAGGGCAGTCCTGACAAGTGG - Intronic
937225586 2:120367022-120367044 GCCAGCTCACTCCCAGCATGCGG - Intergenic
938795295 2:134713756-134713778 ACCAGCACAGTCCCAACTGGTGG + Intronic
941811218 2:169757502-169757524 GCCAGCTTAGTCCCAACAGCAGG - Intronic
942685474 2:178526263-178526285 GCCAGAGCAGTGCCAACTCTTGG - Exonic
1170090894 20:12588952-12588974 GCCAGAGCAGTCACATCACATGG + Intergenic
1173790368 20:45824199-45824221 GCTTCCGCACTCCCAACACGGGG + Intronic
1175959170 20:62626384-62626406 CCCACCGCAGTCCCAACCCAGGG + Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1179005909 21:37514258-37514280 GGCAGCGTAATCTCAACACGAGG - Intronic
1179400186 21:41076209-41076231 GCCAGCGCTGTGCCAGCACCTGG + Intergenic
1180172148 21:46065107-46065129 GCCAGCGCACTCCCAAGCAGTGG - Intergenic
953871216 3:46629247-46629269 GCCAGCCCAGGCCCAACTCCGGG + Intergenic
957771320 3:84696030-84696052 GCCAAAGCAGGCCCACCACGTGG + Intergenic
958128103 3:89383501-89383523 GCCAGGGCAGTTCCAGCACAGGG - Intronic
969480170 4:7442727-7442749 CCCAGCCCAGCCCCAGCACGTGG + Intronic
974304813 4:60121341-60121363 GCCAGGGCAGTCGAATCACGAGG - Intergenic
985836928 5:2278347-2278369 GCAGGCGCTGTCCCACCACGAGG - Intergenic
998883175 5:146665681-146665703 GCCAACACAGGCCCAACACTGGG - Intronic
1004352658 6:14903791-14903813 GCCAGCTCAGACCTAAGACGTGG - Intergenic
1013117791 6:107115505-107115527 GCCAGCGCAGTGGCTCCACGTGG + Intergenic
1019628624 7:2034657-2034679 GCCACAGCAGTCCCCACACTCGG + Intronic
1022104480 7:27188420-27188442 GCCAGCATATTCCGAACACGAGG - Intergenic
1024601179 7:50982894-50982916 ACCAGCACAGTCCCTGCACGGGG - Intergenic
1034888426 7:154817231-154817253 GCCAGTGCCTTCCCAACAAGTGG - Intronic
1035733240 8:1867534-1867556 GCGAGCGCATTTCCAACACGCGG + Intronic
1036660200 8:10702828-10702850 GCCAAAGCAGGCCCAACACTGGG - Intronic
1039380349 8:37079242-37079264 TCCTGAGCAGTCCCAACACCTGG + Intergenic
1049188534 8:141272606-141272628 GCCAGCCCAGCCCAACCACGGGG + Intronic
1049658004 8:143807280-143807302 GGCAGCGCAGTCCTCACTCGAGG - Intronic
1049683923 8:143931722-143931744 CCCAGGGCAGGCCCAAGACGGGG + Intronic
1054884127 9:70177554-70177576 CCTAGCGCAGTGCCTACACGTGG - Intronic
1057203360 9:93155817-93155839 GCCTGCTCAGTGCTAACACGGGG + Intergenic
1061284294 9:129613437-129613459 GCCAGCGCAGTCCCAACACGAGG + Exonic
1185715159 X:2335684-2335706 GCCAGGGCAGGCAGAACACGAGG - Intronic
1192045940 X:67674475-67674497 GCCAGCTCAGTCACAGCTCGAGG - Intronic