ID: 1061284453

View in Genome Browser
Species Human (GRCh38)
Location 9:129614082-129614104
Sequence CTGGCCATAAGGAGCTATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061284453 Original CRISPR CTGGCCATAAGGAGCTATCA TGG (reversed) Intronic
901129533 1:6953622-6953644 CTGGGCATAAGGAGGTGACAAGG - Intronic
906960677 1:50417747-50417769 CTGTCCCTAAGGAGCCGTCAAGG - Exonic
907807216 1:57832871-57832893 CTGGCCTTAGGGAGTTATTATGG + Intronic
919434409 1:197539087-197539109 ATGGCCATAAGGTGCTTCCAGGG - Intronic
921980526 1:221252354-221252376 CTAGCCTAAAGGAACTATCATGG + Intergenic
1074568138 10:114600229-114600251 ATGGCCATGAGGAAATATCAAGG - Intronic
1076487325 10:130832788-130832810 CTGACCAGAAGGAACTATAAGGG - Intergenic
1076610703 10:131724258-131724280 CTGTCCATAAAGAGGAATCACGG - Intergenic
1077120014 11:902878-902900 CTGGCCAGAAGAGGCCATCACGG + Intronic
1078721422 11:13887744-13887766 ATGGCCATAAAGAGCAATGAGGG - Intergenic
1079073401 11:17367707-17367729 CTGAGGATAAGGGGCTATCAGGG + Intronic
1085778893 11:79390703-79390725 CTGGCCTTCAGGAGCTTACATGG - Intronic
1088811338 11:113394878-113394900 CTGGTCATGAGGCTCTATCACGG + Intronic
1095378595 12:41561074-41561096 CTGGTCATAATGAGTTCTCAGGG + Intronic
1097198899 12:57261461-57261483 GTAGTCATAAGGAGCTATTAGGG + Intronic
1103300257 12:119920805-119920827 ATGGCCAAAAGGAGCCACCACGG - Intergenic
1106769812 13:32951160-32951182 TTGCCCATAAGGAGGGATCATGG + Intergenic
1109667889 13:65563197-65563219 CTGGCCATAAGTAGTTTTCGGGG - Intergenic
1114346407 14:21799830-21799852 CTGGCCGTAAAGAACTATTAAGG + Intergenic
1114757736 14:25279370-25279392 CTGGCCATAAACAACTGTCATGG + Intergenic
1115598201 14:34929431-34929453 CTGGACATAAGGAGCCAGGAAGG - Intergenic
1117437758 14:55733055-55733077 CTTACCATCAGAAGCTATCACGG - Intergenic
1118280195 14:64421247-64421269 CTGCCCTTGAGGAGCTATCTAGG - Intronic
1120968184 14:90185862-90185884 CTGGCCACAATGAGCACTCATGG - Intergenic
1121333887 14:93064961-93064983 CTGCCCATAATGAACTAGCACGG + Intronic
1122959975 14:105089884-105089906 CTGGCCTTCGGGAGCTGTCAGGG - Intergenic
1123518368 15:21050218-21050240 CTGGCCATGATGAGCAAACATGG + Intergenic
1128707798 15:69850491-69850513 CAGGCCATATGGAGCTGTGAGGG + Intergenic
1128809597 15:70561238-70561260 CTGGCCATCACTAGCTTTCATGG - Intergenic
1130960174 15:88653772-88653794 CAGGACACAAGGAGCTAACATGG + Intronic
1137621512 16:49879551-49879573 CTAGCTATTGGGAGCTATCAGGG + Intergenic
1138249419 16:55490593-55490615 CTGGCCATTATGGGCCATCAGGG - Intronic
1140707390 16:77643404-77643426 CTGGCCTTAAAGAGCTGACAAGG + Intergenic
1203143572 16_KI270728v1_random:1784629-1784651 CTGGCCATCGAGAGCTTTCAGGG + Intergenic
1146929833 17:36769120-36769142 CTGGCCATAAGGAATCAGCAAGG - Intergenic
1149559879 17:57601043-57601065 CAGGCCAAAAGGGGCTTTCAGGG + Intronic
1150274031 17:63884523-63884545 CTGGCTAAAAGGACCTGTCATGG - Intergenic
1151910557 17:77080038-77080060 CAGACCATAGGGAGCAATCAGGG + Intergenic
1153162477 18:2223355-2223377 CTGGCCATCATGAGCCATCTTGG + Intergenic
1161153835 19:2722256-2722278 CAGGCCAGAAGGTGCTCTCAGGG + Intronic
1163198357 19:15742328-15742350 CTGGCCATTAGGAGCTTAGAGGG - Exonic
1165261324 19:34621471-34621493 CAGGCCATCAGAAGCTATCTAGG + Intronic
1168230473 19:55027520-55027542 ATGGCCATCAGGACCTATAAAGG + Intronic
1168692274 19:58384427-58384449 AAGGCATTAAGGAGCTATCACGG + Intergenic
926857989 2:17278467-17278489 CAGGCCAGAGGAAGCTATCAGGG - Intergenic
927421180 2:22932415-22932437 CTGGCCATAAGGAAGTAACTGGG + Intergenic
929036762 2:37700456-37700478 CTGGCCTTAAGGATCTTCCATGG + Intronic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930239389 2:48920711-48920733 ATAGCAACAAGGAGCTATCATGG - Intergenic
934761522 2:96859474-96859496 CTGGCCAGAAGGAGAAGTCAGGG - Intergenic
935197121 2:100823721-100823743 CTGCCCTTGAGGAGCTAACAAGG + Intronic
938956011 2:136298989-136299011 CTGCACATCAGGATCTATCATGG - Intergenic
945097990 2:206237827-206237849 CTGGTCATAAAGATCTAACAGGG + Intergenic
1170902211 20:20475241-20475263 CTGCCCATAAAGAGCTGACATGG + Intronic
949738990 3:7208307-7208329 CTGGCCATAAGGAGACAGAAAGG + Intronic
949807330 3:7970020-7970042 CTGGCCATATGGATCAGTCAGGG - Intergenic
953206052 3:40830404-40830426 CAGGCCATAAGGAGAAAACAGGG - Intergenic
961571421 3:127801980-127802002 CTGGCCAGACAGAGCTCTCAAGG - Intronic
961637452 3:128342330-128342352 CTGGACATAAGCAGCTTGCAGGG - Intronic
962612921 3:137095954-137095976 CTGGCGAAAATGAGCTGTCATGG - Intergenic
963047416 3:141112838-141112860 CTGGCCTCAAGGAGCTTTCCAGG + Intronic
971943258 4:33241798-33241820 CTGGCCAAAAGAAGCTGTGAGGG - Intergenic
977106697 4:92894952-92894974 CTGGCCATAAATAGCAATTATGG - Intronic
978414442 4:108460566-108460588 CTGGCCAAAAGGATCTTTTATGG - Intergenic
990250014 5:53903898-53903920 CTGGCCCTATGGAGCTTACATGG + Intronic
990974107 5:61542372-61542394 CTGGCCATAAGAAGATTTCCTGG + Intronic
991132912 5:63145604-63145626 CAGGCCATAAGAAGCTGTGACGG - Intergenic
1000011003 5:157232842-157232864 CTGGCCATGGGGTGCCATCAGGG + Intronic
1002179297 5:177421984-177422006 ATGGCCACAAGTAGCTTTCAAGG - Intronic
1002440364 5:179261460-179261482 CTGGCCCTGAGCAGCCATCAGGG - Intronic
1003291088 6:4778527-4778549 CTTGCCATATGGAGGTTTCATGG + Intronic
1006104837 6:31710329-31710351 CTGGGGAGAAGGAGCCATCAGGG - Intronic
1013310440 6:108888929-108888951 CAGGCAATAAGGAACTGTCATGG - Intronic
1015216361 6:130755024-130755046 TTGGCCTTCAGGAGCTCTCATGG + Intergenic
1024012352 7:45279814-45279836 CTAGCCATAAGCAGCCAGCAGGG + Intergenic
1024581148 7:50802117-50802139 GTGGACAGAAGGAGCTAGCAAGG + Intergenic
1041183327 8:55271633-55271655 CTGGCCATCAGCCGCCATCAGGG - Intronic
1042468566 8:69157399-69157421 GAGGCCATGAGGAGCTGTCAAGG - Intergenic
1046175100 8:110565318-110565340 CTGACCATAAAGAGCAATAAAGG + Intergenic
1051102396 9:13535922-13535944 CTGGCCCTGAGGAGCTCCCAGGG - Intergenic
1052748643 9:32466241-32466263 CTGACCATAAATAACTATCAGGG - Intronic
1057147167 9:92765789-92765811 CTGGCCATTAGGTGCTATGGCGG - Intergenic
1061284453 9:129614082-129614104 CTGGCCATAAGGAGCTATCATGG - Intronic
1190110489 X:47586123-47586145 GAGGCCATCAGGAGCCATCAGGG - Intronic
1191971403 X:66820791-66820813 CTGGCCTTCAGCAGCTTTCAAGG - Intergenic
1197270556 X:124420368-124420390 CTGGCCTTAATGACCTATCCAGG - Exonic
1198427545 X:136535140-136535162 CTGCCCACAAGGAACTCTCAAGG + Intronic