ID: 1061284487

View in Genome Browser
Species Human (GRCh38)
Location 9:129614254-129614276
Sequence GAAACCAAGGCCCCAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061284487_1061284493 1 Left 1061284487 9:129614254-129614276 CCTGCTTCTGGGGCCTTGGTTTC 0: 1
1: 0
2: 3
3: 25
4: 257
Right 1061284493 9:129614278-129614300 CCACCAAACAAACAGAAGTTGGG No data
1061284487_1061284491 0 Left 1061284487 9:129614254-129614276 CCTGCTTCTGGGGCCTTGGTTTC 0: 1
1: 0
2: 3
3: 25
4: 257
Right 1061284491 9:129614277-129614299 CCCACCAAACAAACAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061284487 Original CRISPR GAAACCAAGGCCCCAGAAGC AGG (reversed) Intronic
900596312 1:3481708-3481730 GAAGCCAGGGCCCCAGACCCAGG - Intergenic
901211189 1:7526931-7526953 GAAACACAGGCCCCAGCAGCTGG - Intronic
901491707 1:9600011-9600033 GAACCAAAGGCCCCAGGAGAGGG + Intronic
902570175 1:17342140-17342162 GAAGCCCAGGCCCCCGATGCAGG - Intronic
902995049 1:20217961-20217983 GAAACCCAGGAAGCAGAAGCTGG + Intergenic
903021693 1:20399652-20399674 GAAACAAAGGCCCCAGAAAGGGG + Intergenic
903227487 1:21902016-21902038 GCAACCCAGGCCCCAGACACAGG + Intronic
903376225 1:22867975-22867997 GAAACCCAGGCCCCCAAAGGGGG + Intronic
903581276 1:24372801-24372823 GAACCTTGGGCCCCAGAAGCAGG - Intronic
903649865 1:24915953-24915975 GAAACCGAGGCCACACAGGCAGG + Intronic
905469254 1:38179504-38179526 GCAGCCAATGCTCCAGAAGCCGG - Intergenic
905560538 1:38923439-38923461 GAAACCTTGGACCCAGGAGCTGG - Intronic
906483817 1:46219650-46219672 GAAACCCATGCCCCAGAACTGGG + Intronic
906673108 1:47673680-47673702 GAAACCAAGGAAACAAAAGCTGG - Intergenic
907464294 1:54624708-54624730 GACAGCAAGGCCCCCGATGCTGG + Intronic
907482922 1:54757160-54757182 GAAACTGAGGCCCCAGCAGGGGG + Exonic
907937805 1:59058165-59058187 GAAAGGGAGTCCCCAGAAGCAGG + Intergenic
910616400 1:89203533-89203555 GATACAAAGGCTCCACAAGCAGG - Intergenic
912401651 1:109398077-109398099 GAATCCAGGACCCCCGAAGCCGG - Intergenic
912528035 1:110299416-110299438 CTTCCCAAGGCCCCAGAAGCTGG + Intergenic
913192566 1:116426105-116426127 GCAGCGAAGGCCCCAGAATCTGG + Intergenic
915570076 1:156740563-156740585 GAAATCAAGGCCCTGAAAGCCGG + Intronic
915974397 1:160375423-160375445 GAAGTCAAGGCCCCAGGGGCTGG + Intergenic
916758072 1:167792207-167792229 GAAACCAGAGCCCCAGCAGGTGG - Intergenic
918279237 1:182987040-182987062 GAATCCCAGGCCCAAGAAGGAGG - Intergenic
920234404 1:204493454-204493476 GCTACGAAGACCCCAGAAGCGGG + Intronic
920360842 1:205415086-205415108 TAAACCCAGGCCGCAGATGCAGG + Intronic
920865383 1:209747967-209747989 CAAACGTAGGCCCCAGCAGCCGG - Intergenic
922385399 1:225076165-225076187 GAACCCAAGGCCACTGAAGGTGG + Intronic
922411375 1:225378998-225379020 GAAACCAGGGCCCCGGGAGGTGG - Intronic
1065487092 10:26246113-26246135 GAAACGAAGGCTGCAGAGGCTGG - Intronic
1065932243 10:30490279-30490301 CAACCCAAGCCCCCAGGAGCTGG + Intergenic
1067205502 10:44208755-44208777 GAGACCAAGGCCAGAGAACCTGG + Intergenic
1067368392 10:45658321-45658343 GAAAGCAAACCCCCAGGAGCTGG + Intronic
1070053051 10:72907559-72907581 GAAGCCAAGGCTCCAGGAGAGGG - Intronic
1072730937 10:97846179-97846201 GAATCCAAGGGCCCTGACGCAGG - Intergenic
1072895083 10:99359680-99359702 GAAAATAAGGCCCCAGAATCCGG - Intronic
1073114966 10:101086859-101086881 GAAAACAGGGTCCCAGAAGGAGG + Intergenic
1073511956 10:104048064-104048086 GACACCAAGGCCCAAGAGGTTGG - Exonic
1073939155 10:108674002-108674024 GAAACCTAAGCCCCAAAAGTAGG - Intergenic
1075090846 10:119443583-119443605 GCAGCCAAGGCCCCAGTAGTCGG - Exonic
1076597735 10:131636253-131636275 GGAAACACGGCCCCAGAAGTCGG + Intergenic
1077504841 11:2925161-2925183 GAAACCTATGCCCCAGAGGAAGG + Exonic
1077546287 11:3171593-3171615 GAAATCAAGGTCTCAGCAGCTGG + Intergenic
1077818404 11:5711255-5711277 GAAACCAGAGACCCAAAAGCTGG + Intronic
1078060299 11:8038990-8039012 GAAACCTGGGCCCCTGAAACGGG + Exonic
1078317845 11:10306807-10306829 GAAGCGAAGCCCCCAGAAGGAGG - Exonic
1078350032 11:10585452-10585474 GAAACCAAGGCTCAAAAAGTAGG + Intronic
1078663184 11:13303656-13303678 GAAACCAAGGCCCTTGAAGAAGG - Intronic
1079128260 11:17733828-17733850 TAAACCAAGGCACTAGCAGCAGG + Intergenic
1079697951 11:23507490-23507512 GATCCCCAGGCTCCAGAAGCAGG + Intergenic
1080884790 11:36356799-36356821 AATACCAAGGCCCCAGGAGAGGG - Intronic
1083328228 11:61884591-61884613 GAAGCCAAGGGCCCAGCTGCTGG + Intronic
1083615323 11:64023347-64023369 GAAACTGAGGCCCCAGGAGGTGG - Intronic
1085257294 11:75182348-75182370 GAAACTGAGGCCCCAAAAGGGGG - Intronic
1087662412 11:101002819-101002841 CAAACAAAAGCCCGAGAAGCAGG - Intergenic
1088787351 11:113194137-113194159 GAAACCAACTAGCCAGAAGCAGG - Intronic
1088996914 11:115008810-115008832 GAAACTAAGGCCCAAAAGGCTGG + Intergenic
1090357238 11:126148093-126148115 GACCCCATGGCCCCAGAGGCAGG - Intergenic
1091585770 12:1815720-1815742 GTCAGCAAGGCCCCTGAAGCTGG - Intronic
1092003340 12:5048826-5048848 GCAACCAAGGCCCAGAAAGCAGG + Intergenic
1093431061 12:19085347-19085369 GAAGGCAAGGACCCAGAGGCCGG - Intergenic
1100020475 12:90063115-90063137 GATTCCCAGGCCCCAGAAGATGG + Intergenic
1105284531 13:18993564-18993586 GAAACCCAGGCCAGAGAAACAGG + Intergenic
1106679810 13:31998443-31998465 AAAACGAAAGCCCCAGAATCAGG - Intergenic
1106868716 13:33995815-33995837 GAAATCAAGGCCCCAGAGGCAGG - Intergenic
1107565630 13:41601077-41601099 GGAAACAACGCCCCAGAAGAGGG - Intronic
1108578297 13:51807730-51807752 AAAACCGAAGCCCTAGAAGCAGG - Intergenic
1108718409 13:53105202-53105224 TAATACAAGACCCCAGAAGCAGG - Intergenic
1109483512 13:62988146-62988168 GTAACAAAGGCATCAGAAGCAGG - Intergenic
1112240409 13:97676045-97676067 GCAGCCATGGCCACAGAAGCTGG + Intergenic
1113476061 13:110582186-110582208 GAAACCAAAGCCCCAGGAAACGG - Intergenic
1114881858 14:26796162-26796184 TAAGGCAAGGTCCCAGAAGCAGG + Intergenic
1115498961 14:34032514-34032536 GAAACCAACCCCCCGGAAGTTGG + Intronic
1116487139 14:45463530-45463552 CCAACCAAGTCCCCAGATGCGGG + Intergenic
1116772402 14:49142816-49142838 GAAACCAAGGGCTCAGAAATTGG - Intergenic
1118313714 14:64711115-64711137 GAAACCAAGTCCCCACGAGTTGG + Intronic
1118443272 14:65830678-65830700 GAAACCAATACCCCAAAATCTGG - Intergenic
1118746955 14:68781202-68781224 GAAAACAAGGCACCAAAAGAGGG + Intergenic
1121180223 14:91923328-91923350 GAATTCAAGGCCCCACAATCTGG + Intronic
1121619142 14:95334078-95334100 GCAAACAAGGCACCAGATGCTGG - Intergenic
1122092091 14:99347566-99347588 TAAACCCAGGCCCAACAAGCTGG - Intergenic
1122648326 14:103209720-103209742 GAAAGCAAGGTCACAGGAGCTGG - Intergenic
1122940092 14:104977345-104977367 GACACCCAGGCCCCGGAACCAGG + Intronic
1125341147 15:38676879-38676901 GAAAAAAAGGCCACAGCAGCAGG + Intergenic
1125686288 15:41565220-41565242 CAGACCAAGCCCCCAGGAGCTGG - Intronic
1126795244 15:52255206-52255228 GAACCCAAGGTCCCAGAGGGAGG + Intronic
1127279784 15:57479116-57479138 TAAACCAGGGACCCAAAAGCTGG - Intronic
1128257691 15:66210693-66210715 GAAACCGAGGCCCAGGAAGAGGG + Intronic
1128864384 15:71103206-71103228 GAAACCACAGCCCAAGAGGCAGG - Intronic
1128917690 15:71579443-71579465 GTAAACAAGTCCCCAGAAGAGGG + Intronic
1129924975 15:79355744-79355766 GAAACCAAGCTCCAAGGAGCCGG + Intronic
1131217033 15:90546416-90546438 GAAACCAATGACACAGAAGATGG - Intronic
1132887912 16:2190545-2190567 GACACCAAGGCCCGAGCAGCTGG - Intronic
1133450215 16:5897617-5897639 GAAACCAAGGCCCCTCAAGGTGG + Intergenic
1133881434 16:9786314-9786336 AAAACTAAGGACCCAGAAGCAGG - Intronic
1134347946 16:13409030-13409052 GAACCCCAGGCTCCGGAAGCAGG + Intergenic
1139691885 16:68646368-68646390 GCATCCCAGGCCCCAGACGCTGG - Intronic
1140267656 16:73434342-73434364 GAAACCAAAGCCCCTGAAGCAGG + Intergenic
1141699184 16:85634667-85634689 GAAGCCAAGGCTCCAGACCCCGG - Intronic
1142149702 16:88507219-88507241 AAAAGCAAGGCCTGAGAAGCTGG - Intronic
1142243768 16:88959083-88959105 GATGCCAAGGTCCCAGCAGCTGG + Intronic
1142502236 17:339620-339642 GTGCCCAAGGCCCCATAAGCTGG + Intronic
1143275459 17:5706523-5706545 CAAACCAAGGCACCAGATGCTGG - Intergenic
1145273293 17:21415891-21415913 GATGGCAAGGCCCAAGAAGCGGG + Exonic
1145311482 17:21703335-21703357 GATGGCAAGGCCCAAGAAGCGGG + Exonic
1145901069 17:28490872-28490894 GGAACCAAGTCCCCAGAAGGAGG + Exonic
1146373301 17:32278687-32278709 GAAACCAAGGCACCAAGAGCTGG - Intronic
1146808086 17:35881361-35881383 GAAACCAAGGCCCAGTGAGCAGG + Intergenic
1147216941 17:38906173-38906195 GAAACCAAGGCTCAAGATGTGGG - Intronic
1147794920 17:43035433-43035455 GAAACGAAGGCCCCGGGAACAGG + Intergenic
1148397231 17:47318840-47318862 AAAACCAAGAGCCCAGAAGGTGG - Intronic
1151355952 17:73558668-73558690 GAAACCAAGGCCCAATGAGATGG + Intronic
1151400059 17:73850197-73850219 GAAATCAAATCCACAGAAGCAGG + Intergenic
1153202045 18:2656364-2656386 GAAGCCAAGGCCGCAGGACCGGG - Intronic
1153731499 18:8017692-8017714 GAAAACAAGTTCCCAGGAGCAGG + Intronic
1154348810 18:13566075-13566097 GACACCACAGCCCCAGGAGCAGG - Intronic
1155517850 18:26640954-26640976 GTAGCCAAGATCCCAGAAGCAGG + Intronic
1156872110 18:41957226-41957248 GAAACCAAGGCCTAGAAAGCTGG + Intronic
1157825302 18:50806820-50806842 GAAACTGAGGTTCCAGAAGCGGG - Exonic
1158687986 18:59632176-59632198 GAAACCAAGGCCCCCAAAAATGG + Intronic
1158836188 18:61333853-61333875 GAGTCCCAAGCCCCAGAAGCGGG - Intronic
1160531585 18:79568113-79568135 GAAACTCAGAGCCCAGAAGCCGG - Intergenic
1160764343 19:800788-800810 GAAAGCAGGCCCACAGAAGCAGG - Intronic
1161008742 19:1949768-1949790 GAAACCAAGTCACCGGAAGAGGG - Intronic
1161454445 19:4363050-4363072 TACGCCAAGGCCCCTGAAGCAGG + Intronic
1161566464 19:5005524-5005546 GAAACTGAGGCCCCAGAGGTGGG + Intronic
1162850326 19:13426132-13426154 GAAAACAAGGCACCAGAATGAGG + Intronic
1162908942 19:13839426-13839448 GAAACCAAGCTCCTAGCAGCTGG + Intergenic
1164393694 19:27846211-27846233 GATACCAAGGGCCTAGAGGCCGG + Intergenic
1165077277 19:33286867-33286889 GATGCTGAGGCCCCAGAAGCTGG + Intergenic
1165449734 19:35875072-35875094 GAATCCAAGGGCCAAGAAGCAGG - Intronic
1166669338 19:44700722-44700744 GAAAACAAGGCCTCCGAAGTGGG + Intronic
1167592892 19:50413996-50414018 CAAACCAAGGCCCCAGCCTCAGG - Intronic
1168320106 19:55503990-55504012 GCAACCAGGCCCCAAGAAGCGGG + Intronic
925732298 2:6928000-6928022 CAAACCAGGCCCCCAGATGCAGG - Intronic
926251150 2:11156069-11156091 GAAACCGAGGCCCGAGAACGAGG - Intronic
926577369 2:14596867-14596889 GAATCCATGGCCTGAGAAGCGGG - Intergenic
926861496 2:17315014-17315036 GATTCCAAGGCTCCAGAATCAGG + Intergenic
928502207 2:31908514-31908536 CAAACCAATGCCCCAAAAACTGG + Intronic
929814336 2:45219471-45219493 GAAACCAAGGAGCCAGAGCCAGG + Intergenic
931936888 2:67208473-67208495 GAAACCAATTTCCCAGAACCAGG + Intergenic
932286007 2:70532456-70532478 TGAGCCAAGGCCCCAGAGGCTGG - Intronic
933280997 2:80332602-80332624 GGAAGGAAGGCCCCAGAAGAAGG + Intronic
934681932 2:96290262-96290284 GACACCAAGGCACCAGGAGTGGG - Intronic
934920962 2:98345275-98345297 GAAGCCAAAGCCACAGAAGTTGG - Intronic
936376047 2:111942300-111942322 GAAACCAAGGCTACTGAAGAGGG - Intronic
937132121 2:119521810-119521832 GAAAGCAGGGCTCCAGAGGCTGG + Intronic
941079011 2:161038812-161038834 GAAACCAAGTTCACATAAGCTGG + Intergenic
943951837 2:194139353-194139375 AAAAGCAATGCCCCAGAAGGAGG - Intergenic
944572998 2:201063304-201063326 GAATGCAAGGCCACAGAAGGTGG + Intronic
945036641 2:205709224-205709246 GAAACCCAGCCCCAAGAAGCAGG + Intronic
948058233 2:235025369-235025391 GAAACCAATGCCACAGGAGAGGG - Intronic
948504965 2:238422496-238422518 GGAGCCAAGGCCCCAGCTGCGGG + Intergenic
948685728 2:239668520-239668542 CAGGCCAAGGCCCCAGAAGAAGG + Intergenic
1169223672 20:3842382-3842404 GCAAGCAGGGCACCAGAAGCTGG + Intergenic
1169285874 20:4306656-4306678 TAAACCAAGGCCCAACAAGAAGG - Intergenic
1170842965 20:19938954-19938976 GAGTACAAGGCCCAAGAAGCTGG - Intronic
1171339850 20:24419374-24419396 GAAACCAGAGCCCCACATGCTGG + Intergenic
1171424187 20:25039274-25039296 GACAGCAAGGCCCCTGGAGCTGG - Intronic
1172095933 20:32460524-32460546 GAAACGGAGGCTCCAGAAGGTGG - Intronic
1174279324 20:49427421-49427443 GTAAGCAAAGGCCCAGAAGCAGG + Intronic
1174300718 20:49580246-49580268 GAAGGCAAGGCCACAGAACCGGG + Intergenic
1174334566 20:49849761-49849783 GAAACCCAGGCCCCACAAAGTGG - Intronic
1174501881 20:50991181-50991203 GGCACCAGGGCCCCAGAAGCTGG + Intergenic
1174553081 20:51375460-51375482 GAAACCAGGAACCCAGAAGGAGG + Intergenic
1175185601 20:57178046-57178068 GAAAACAAGGCAGGAGAAGCTGG + Intronic
1175437353 20:58963029-58963051 GAAACACAGACCTCAGAAGCTGG + Intergenic
1175529939 20:59667674-59667696 AAAACCTAAGCCCCAGAGGCAGG - Intronic
1178920685 21:36736289-36736311 GAAAGCGAGGCCCCAGAAGAGGG - Intronic
1178922646 21:36748331-36748353 GAAACCAAGCCCCCAGCAACTGG - Exonic
1180868077 22:19131063-19131085 GAAACCAATGCAGCAGCAGCAGG + Exonic
1181182629 22:21078477-21078499 GAAACCAGGGGCCCAGAGCCAGG - Intergenic
1182810385 22:33111229-33111251 GAAACCAAGGTTCCAGAAATGGG - Intergenic
1183084255 22:35476953-35476975 GACATCAGGCCCCCAGAAGCAGG + Intergenic
1183240764 22:36656677-36656699 GAGGCCAAGGCCCCTGGAGCAGG - Intronic
1183387505 22:37523593-37523615 GCCACAAAGGCCACAGAAGCAGG + Intergenic
1183674328 22:39291256-39291278 GGACCCAAGGCCCCAGACACTGG + Intergenic
1183678585 22:39313566-39313588 GGATCCAAGGCCACAGACGCTGG - Intronic
1183683808 22:39350328-39350350 GAAACCAGGGCTCCGGGAGCCGG - Intronic
1183726151 22:39590714-39590736 GAAACTAAGGCCACAGGAGGTGG - Intronic
1183750843 22:39719489-39719511 GGGACCAAGGCCCCAGAATGTGG - Intergenic
1184220721 22:43098086-43098108 GAAACCAAGGCCCAGGGACCTGG - Intergenic
1184278152 22:43422085-43422107 GAAATGAAGGCCCCAGATCCAGG + Intronic
1184406648 22:44304344-44304366 GAGACCAAGGCTGCAGAAGCAGG - Intronic
1184457978 22:44622141-44622163 GAAAGAAAAGCCCCAGAAGTGGG + Intergenic
1184825538 22:46948199-46948221 GAAATCAAAGCCCCTTAAGCAGG + Intronic
1185310276 22:50150485-50150507 GAAAACCAGGCTGCAGAAGCCGG + Intronic
949530126 3:4947405-4947427 GAAACAGAGGCCCCAGGAGCCGG - Intergenic
949926550 3:9046713-9046735 GAATCCAGGGCCTCAGAGGCTGG - Intronic
950178091 3:10890187-10890209 GGAAAAAAGGCCCAAGAAGCAGG + Intronic
950441033 3:13010567-13010589 CAAACCATGACCCCAGACGCCGG - Intronic
953041853 3:39262594-39262616 GAAGCCCAGACCTCAGAAGCAGG + Intergenic
953319970 3:41962710-41962732 ATAACCAACGCCTCAGAAGCAGG + Intergenic
953471905 3:43174901-43174923 GAAAGCAAGTCCCCAGAGTCTGG + Intergenic
955651377 3:61197802-61197824 GAGACCAGGGCCCCAGAAATTGG + Intronic
957196050 3:77070116-77070138 GCCAGCAAGCCCCCAGAAGCTGG + Intronic
958979542 3:100705354-100705376 GAAACCTAGGCCCAATTAGCCGG - Intergenic
961449435 3:126995809-126995831 GAAACCAAGGCCCCAGAGGATGG - Intronic
961663597 3:128483105-128483127 GAAAAAAAGGCCCCCAAAGCAGG + Intronic
962887071 3:139637685-139637707 TAAACAGAGGCCCAAGAAGCAGG - Intronic
964904690 3:161706138-161706160 GAAAACAAGAATCCAGAAGCAGG - Intergenic
967317321 3:188161575-188161597 GAAACTGAGGCCCCAGAAAAGGG + Intronic
968124350 3:196147424-196147446 GAAACCAATACCCCAGAATATGG - Intergenic
968470815 4:781568-781590 GAAGCCGAGGCCTCGGAAGCAGG - Intergenic
968654964 4:1774505-1774527 GGAACCCAGGCCCCAGAAGGAGG + Intergenic
970243106 4:14030014-14030036 GAAACCAAGGACCCAGGAAGAGG + Intergenic
970697127 4:18691483-18691505 GGAACCCAGGGCTCAGAAGCCGG + Intergenic
971497584 4:27283640-27283662 GAAGACAATGCCCCAGAAGATGG + Intergenic
975739459 4:77414904-77414926 GAAGCCAAGGGCCAAGAGGCAGG + Intronic
976286757 4:83378116-83378138 GAAAACATGGCACCAGAAGTTGG + Intergenic
978712041 4:111795233-111795255 GAAACCAAGGCATCTGAAACTGG - Intergenic
979361841 4:119774496-119774518 GAATCCAAGTCTCCAGAAGGAGG - Intergenic
979383686 4:120038481-120038503 AAAACCAAGGACCCAGAGGGTGG + Intergenic
981526385 4:145710390-145710412 GAACACAATACCCCAGAAGCAGG - Intronic
983098027 4:163588311-163588333 CAAACCTAGGCCTCAGAAACTGG + Intronic
983781403 4:171674501-171674523 GAACCCCAGGCTCCAGAAGCAGG + Intergenic
986457223 5:7931589-7931611 AAACCCCAGGCTCCAGAAGCAGG + Intergenic
988727581 5:33939355-33939377 GAAACCAAATTCCTAGAAGCTGG + Intergenic
992221595 5:74579269-74579291 GGAAACAAGGGCCCGGAAGCCGG - Intergenic
996513592 5:124344881-124344903 GAAACCAATGCCCCAAAATATGG - Intergenic
996862296 5:128081337-128081359 GAAACCAAAGACCCAAAGGCAGG - Intergenic
997207236 5:132057016-132057038 GAATGGAAGGCCCCAGAGGCAGG - Intergenic
997400703 5:133599720-133599742 GACACCCAGGCCCCAAAAGTGGG + Intronic
997849050 5:137314374-137314396 TAAATCAAGCCCACAGAAGCTGG - Intronic
998106665 5:139473265-139473287 GAATCCAACTCCCCACAAGCAGG + Intergenic
999767707 5:154754393-154754415 GAAACTGAGGCCCACGAAGCTGG + Intronic
999811481 5:155131509-155131531 GAACCCCAGGCTCCAGAAGCAGG - Intergenic
1001655461 5:173345441-173345463 GAAAACAGGGCCCATGAAGCAGG - Intergenic
1002332177 5:178450817-178450839 GAAACCAAGGCCCAAGAAAGTGG + Intronic
1003448544 6:6208368-6208390 AAAATCAAAGCCCCAGAAACAGG + Intronic
1005495936 6:26388036-26388058 GAAATCAAGGCCCAAGAGGATGG + Exonic
1005704237 6:28435686-28435708 GAAAAGAAGGACCAAGAAGCTGG + Intronic
1006099107 6:31674801-31674823 GAGTCCAGGGCCCCAGCAGCAGG - Intergenic
1007165647 6:39827245-39827267 GAAACTGAGGCCCAAGAAGCAGG - Intronic
1007218749 6:40261999-40262021 GAGGCCAAGGCCACAGAGGCTGG - Intergenic
1007960678 6:45956338-45956360 GAAACCATGGCCCCCGCAGGTGG + Intronic
1010465269 6:76160693-76160715 GTAACCAAGGCCCAACAAGATGG + Intergenic
1013610787 6:111793382-111793404 TAAACCAAGGCCCCAGGAAACGG - Intronic
1016846225 6:148570970-148570992 GCCAGCAAAGCCCCAGAAGCAGG - Intergenic
1019550952 7:1602272-1602294 GAAGGCACGGCCCCAGCAGCCGG - Intergenic
1021472776 7:21024632-21024654 GGAACTGAGGCTCCAGAAGCAGG - Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029021493 7:97369517-97369539 TAAACAAAGGCCTCAGAACCAGG + Intergenic
1030208784 7:106976106-106976128 GAAACTAAGGCCATAGAAGGAGG + Intergenic
1031201769 7:118697357-118697379 CAATCCAAGGCCCTAGAACCAGG - Intergenic
1033199761 7:139359121-139359143 GAAGCCAAGGCCCCAGTCACGGG + Intronic
1035155553 7:156909231-156909253 GGCTCCAAGGCCCCAGGAGCAGG - Intergenic
1037655473 8:20880100-20880122 GAAACCAATGCTCCGGAGGCTGG - Intergenic
1039447733 8:37646187-37646209 GAAACCAAGGACCTGGAAACAGG + Intergenic
1039635861 8:39164151-39164173 GACACCAAAGGCTCAGAAGCGGG - Intronic
1040445851 8:47492630-47492652 GAAAAGAAGGGCCCAGAAGTAGG - Intronic
1041590273 8:59572295-59572317 GGAACCAAAAACCCAGAAGCAGG + Intergenic
1041957429 8:63571551-63571573 GAAACCATGTCCCTAGAAGATGG - Intergenic
1042449519 8:68928315-68928337 GAAATCAAGGCACCAGAATTTGG - Intergenic
1043589172 8:81807987-81808009 GAATGCAAGGCCACAGAAGGTGG + Intronic
1046152387 8:110244651-110244673 GAAAGCAAGGTGCCAGAAGTGGG - Intergenic
1046152570 8:110246949-110246971 GAAAGCAAGGTTCCAGAAGTGGG - Intergenic
1046526241 8:115385427-115385449 GATTCTAAGGCCTCAGAAGCAGG + Intergenic
1046591573 8:116213570-116213592 GAAACTAAGGAACCAGAAACTGG - Intergenic
1048847277 8:138613370-138613392 GCCAGCAAAGCCCCAGAAGCTGG + Intronic
1049264613 8:141660779-141660801 GGAACTGGGGCCCCAGAAGCAGG - Intergenic
1049351612 8:142167582-142167604 GGGACCAGGACCCCAGAAGCTGG + Intergenic
1050423739 9:5493074-5493096 GACACCAAGGGCAGAGAAGCTGG - Intergenic
1056008529 9:82301450-82301472 GAATACAAGGCCCCAAATGCAGG - Intergenic
1057191334 9:93089476-93089498 GAAAGCAAGCCCACAGAATCGGG - Intergenic
1058670899 9:107359683-107359705 GAACTCAAGGTTCCAGAAGCAGG + Intergenic
1058781781 9:108344309-108344331 GAAACCAAGGCCCCACATGGAGG - Intergenic
1059723084 9:116980522-116980544 GAAACTAAGGCCCCAAAAGGAGG - Intronic
1060569982 9:124629509-124629531 GAAACTGAGGCTCCAGAAGATGG + Intronic
1061106550 9:128535272-128535294 GAAGCCAAGGCCGCCAAAGCGGG + Intronic
1061150143 9:128823699-128823721 GATCCCAAGGCCCCAGTGGCTGG + Intronic
1061213324 9:129206092-129206114 GAAACCTGCGCCCCAGAATCAGG + Intergenic
1061284487 9:129614254-129614276 GAAACCAAGGCCCCAGAAGCAGG - Intronic
1061534635 9:131239894-131239916 GAGACCCAGGCCCCAGCAGACGG + Intergenic
1061727675 9:132590307-132590329 GAAACCGAGTCCCCAGGAGAGGG - Intergenic
1062287117 9:135778221-135778243 GAAACCAAGGCCCGGGAGGGTGG - Intronic
1062430532 9:136525139-136525161 GAAACCAAGGTGCCAGGAGGAGG + Intronic
1062650227 9:137572309-137572331 CAAAACAAGGCCGGAGAAGCAGG + Intronic
1187742215 X:22368297-22368319 GACCCAAAGGCCCCAGAACCAGG - Intergenic
1188468619 X:30511638-30511660 GAAACCAAGGCCCCTGCAGAGGG + Intergenic
1189370883 X:40428127-40428149 CAAACCAAAGCCCCAGTAGGAGG - Intergenic
1197739215 X:129876425-129876447 AAACCCGAGGCTCCAGAAGCAGG + Intergenic
1198016884 X:132620470-132620492 GAAATCAAGTTACCAGAAGCTGG + Intergenic
1199007092 X:142713188-142713210 GAACCCAAGGCCACCGTAGCTGG - Intergenic
1200150051 X:153946925-153946947 GAGCACCAGGCCCCAGAAGCAGG + Intergenic