ID: 1061289963

View in Genome Browser
Species Human (GRCh38)
Location 9:129645125-129645147
Sequence CGGTCTCCTCACCTATGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061289960_1061289963 -4 Left 1061289960 9:129645106-129645128 CCCGTGTTGAGTCAGGCCTCGGT No data
Right 1061289963 9:129645125-129645147 CGGTCTCCTCACCTATGTGATGG No data
1061289961_1061289963 -5 Left 1061289961 9:129645107-129645129 CCGTGTTGAGTCAGGCCTCGGTC No data
Right 1061289963 9:129645125-129645147 CGGTCTCCTCACCTATGTGATGG No data
1061289958_1061289963 1 Left 1061289958 9:129645101-129645123 CCATGCCCGTGTTGAGTCAGGCC No data
Right 1061289963 9:129645125-129645147 CGGTCTCCTCACCTATGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061289963 Original CRISPR CGGTCTCCTCACCTATGTGA TGG Intergenic
No off target data available for this crispr