ID: 1061294544

View in Genome Browser
Species Human (GRCh38)
Location 9:129669813-129669835
Sequence TCGCAATAAAAAATAATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2672
Summary {0: 1, 1: 0, 2: 1, 3: 75, 4: 2595}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061294544 Original CRISPR TCGCAATAAAAAATAATTGA AGG (reversed) Intronic
Too many off-targets to display for this crispr