ID: 1061296052

View in Genome Browser
Species Human (GRCh38)
Location 9:129677434-129677456
Sequence GAGCCTAGGCTGCTTCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 103}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061296052_1061296062 2 Left 1061296052 9:129677434-129677456 CCTGCTAGAAGCAGCCTAGGCTC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1061296062 9:129677459-129677481 CCTCTGGGGGAGGCCCAGGAGGG No data
1061296052_1061296065 8 Left 1061296052 9:129677434-129677456 CCTGCTAGAAGCAGCCTAGGCTC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1061296065 9:129677465-129677487 GGGGAGGCCCAGGAGGGATGGGG No data
1061296052_1061296066 9 Left 1061296052 9:129677434-129677456 CCTGCTAGAAGCAGCCTAGGCTC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1061296066 9:129677466-129677488 GGGAGGCCCAGGAGGGATGGGGG No data
1061296052_1061296063 6 Left 1061296052 9:129677434-129677456 CCTGCTAGAAGCAGCCTAGGCTC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1061296063 9:129677463-129677485 TGGGGGAGGCCCAGGAGGGATGG No data
1061296052_1061296064 7 Left 1061296052 9:129677434-129677456 CCTGCTAGAAGCAGCCTAGGCTC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1061296064 9:129677464-129677486 GGGGGAGGCCCAGGAGGGATGGG No data
1061296052_1061296068 11 Left 1061296052 9:129677434-129677456 CCTGCTAGAAGCAGCCTAGGCTC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1061296068 9:129677468-129677490 GAGGCCCAGGAGGGATGGGGGGG No data
1061296052_1061296060 1 Left 1061296052 9:129677434-129677456 CCTGCTAGAAGCAGCCTAGGCTC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1061296060 9:129677458-129677480 GCCTCTGGGGGAGGCCCAGGAGG No data
1061296052_1061296058 -8 Left 1061296052 9:129677434-129677456 CCTGCTAGAAGCAGCCTAGGCTC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1061296058 9:129677449-129677471 CTAGGCTCTGCCTCTGGGGGAGG No data
1061296052_1061296067 10 Left 1061296052 9:129677434-129677456 CCTGCTAGAAGCAGCCTAGGCTC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1061296067 9:129677467-129677489 GGAGGCCCAGGAGGGATGGGGGG No data
1061296052_1061296059 -2 Left 1061296052 9:129677434-129677456 CCTGCTAGAAGCAGCCTAGGCTC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1061296059 9:129677455-129677477 TCTGCCTCTGGGGGAGGCCCAGG No data
1061296052_1061296071 29 Left 1061296052 9:129677434-129677456 CCTGCTAGAAGCAGCCTAGGCTC 0: 1
1: 0
2: 2
3: 8
4: 103
Right 1061296071 9:129677486-129677508 GGGGGTTCCTCCCCACCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061296052 Original CRISPR GAGCCTAGGCTGCTTCTAGC AGG (reversed) Intronic
900990167 1:6095079-6095101 GAGCCTGGGCTGCTCATAACTGG + Intronic
902658414 1:17885247-17885269 GAGCCCAGGCTACTTCAGGCTGG + Intergenic
903051399 1:20603865-20603887 AAGCCAAGGCTGCTCCTAGGAGG - Intronic
903701545 1:25252436-25252458 GAGCCTAGGCTGTTGCTTCCCGG - Intronic
905223933 1:36467255-36467277 GAGCCCAGGCTGCTGTGAGCTGG + Exonic
912214315 1:107590078-107590100 GAGCCTAGGCTGTCTCTCCCTGG - Intronic
913693642 1:121303532-121303554 GAGCCTCGGTTGCTTTTAGTGGG + Intronic
914143916 1:144976548-144976570 GAGCCTCGGTTGCTTTTAGTGGG - Intronic
915950470 1:160186880-160186902 AAGCCCAGCCTGCATCTAGCTGG + Exonic
919234681 1:194825405-194825427 GAGCCTAAGCTCCATGTAGCAGG - Intergenic
920260271 1:204684315-204684337 GAGCCAACGCAGCTTCTAACTGG - Intronic
920480966 1:206321901-206321923 GAGCCTCGGTTGCTTTTAGTGGG + Intronic
924278895 1:242416469-242416491 GATCCTAGGCTTCTTCTGGAAGG - Intronic
1065442713 10:25769299-25769321 GGGCATAAGCTGCTTCAAGCGGG + Intergenic
1070389460 10:75956632-75956654 GGGCCCAGGCTGCTTCTACCTGG + Intronic
1071236067 10:83650069-83650091 GAGCCTAGGCAGGTACTAGCTGG + Intergenic
1073459073 10:103655329-103655351 TAGGCTAGGCTGTTTCTAGAAGG - Intronic
1076812857 10:132898336-132898358 GAGCCTGGCCAGCTTCTCGCTGG - Intronic
1077664260 11:4093986-4094008 GAGCCTGGGCAGCTTCTGGAGGG + Intergenic
1078479725 11:11665201-11665223 GAGCAGAGGCTTCTTCCAGCAGG - Intergenic
1078747468 11:14128858-14128880 AAGCCTTGGCTGCTTCTACGTGG - Intronic
1078848756 11:15144795-15144817 GAGCAAAGGCTGCTTCTAATGGG + Intronic
1079837989 11:25358836-25358858 AACCCTAAGCTGCTTCTAGTTGG - Intergenic
1081848212 11:46256402-46256424 CAGCCTGGGCTGCTTCCTGCTGG - Intergenic
1083736381 11:64683836-64683858 GACCCTCGGCTGCTTCTTCCTGG - Intronic
1084992313 11:72938610-72938632 AAGCTTAGGCATCTTCTAGCAGG + Intronic
1087725138 11:101707836-101707858 AAGCCTTGGCAGCTTCTAGGTGG + Intronic
1096606694 12:52771804-52771826 GAGCTTATGCTGCTTCTCTCCGG + Intronic
1096806227 12:54142855-54142877 CAGCCTGGGATGCTTCTTGCAGG + Intergenic
1104831192 12:131753015-131753037 GAGGCAAGGCTGCATCTTGCCGG + Intronic
1109001745 13:56813472-56813494 CAGACTAGGCTGGTTCCAGCTGG - Intergenic
1110882611 13:80590705-80590727 GAACCTAGGCAGCCTCTAGAAGG - Intergenic
1112477621 13:99746924-99746946 GTTTCTGGGCTGCTTCTAGCAGG - Intronic
1112778334 13:102869984-102870006 GAGCGAAGGCTGCTCCTATCTGG - Intronic
1113200962 13:107867240-107867262 GAGCCTGGGCTGCCTCCGGCGGG + Intergenic
1116759150 14:48989519-48989541 GGGCCTGGGGTGCTTCTAGGTGG + Intergenic
1121407108 14:93725790-93725812 GAACCTTGGCTGCTGCCAGCCGG - Intronic
1121582978 14:95044747-95044769 GAGCCTAGGCTGGTTCTAGATGG - Intergenic
1121915730 14:97835587-97835609 GAGGCTAGGCTGCCTCAGGCTGG + Intergenic
1121928912 14:97954279-97954301 TACCCTAGGCTGCTTCTAGCTGG - Intronic
1123932571 15:25178948-25178970 GAGCCTGGGCTGCCTCAAGGAGG - Intergenic
1123933384 15:25182595-25182617 GAGCCTGGGCTGCCTCAAGGAGG - Intergenic
1124439072 15:29674208-29674230 GAGCGTTTGCTGCTTCTGGCTGG - Intergenic
1132359402 15:101200369-101200391 GAGCCTGGCCTGCTTCTCACAGG + Intronic
1134037577 16:11042475-11042497 CAGCCCCTGCTGCTTCTAGCTGG - Intronic
1138188219 16:54993200-54993222 TAGTCTAGTCTGCTTATAGCAGG + Intergenic
1138528516 16:57622385-57622407 CAGACAAGGCTGCTTCTAGCTGG + Intronic
1138578339 16:57923105-57923127 CTGCCCAGGCTGCTTCTGGCTGG - Intronic
1138993905 16:62425076-62425098 CAGGCTAGGTTGCTTCTAGGGGG - Intergenic
1141768726 16:86075602-86075624 GAGCCTGGGCTTCTTCCAGATGG - Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1145190393 17:20837007-20837029 GAACCTAGGCTGATTTGAGCAGG + Intronic
1149923072 17:60677308-60677330 GAGCCTAGGCTGGCTCGCGCCGG - Intergenic
1158570907 18:58596364-58596386 GAGCCGAGGCAGCCACTAGCAGG + Intronic
1160995548 19:1880551-1880573 GAGCCCATGCTGCTGCTGGCAGG + Intronic
927654716 2:24935471-24935493 CAGCCTTGGCTGCCTCTAGCTGG - Intergenic
936458627 2:112694421-112694443 GACCCTAGGCTGCTGCCAGTTGG + Intergenic
942850186 2:180474963-180474985 GAGACAAGGCTGCTTGTGGCAGG - Intergenic
946844862 2:223850336-223850358 GACCCTAGGCTGCACATAGCAGG - Intergenic
948297250 2:236870694-236870716 GAATCTAGGCTCCTTCCAGCAGG + Intergenic
948853869 2:240721153-240721175 GAGCCAAGGCTGCTGGTAGGAGG - Intronic
1169533051 20:6506096-6506118 CAGCCTAGGCTGCTTCCATTTGG + Intergenic
1170916333 20:20629721-20629743 GAGCCTATCGTGCTTCAAGCTGG - Intronic
1174550824 20:51360281-51360303 GACCCCAGGCTGCTACTACCTGG - Intergenic
1177408304 21:20698847-20698869 ATGCCTAGGCTGCATATAGCAGG - Intergenic
1181391098 22:22581437-22581459 GAGCCAATACTGTTTCTAGCTGG + Intergenic
1181474809 22:23161546-23161568 CAGCCTGGGCTGCTGCTAACTGG + Exonic
1181667027 22:24405424-24405446 GTCCCTAGGCTGCTCCTACCTGG - Intronic
1182261351 22:29074167-29074189 GACCCTAACCTGCCTCTAGCAGG - Intronic
1182847147 22:33440838-33440860 GATCCTAGGGTGCTTTGAGCTGG - Intronic
1183363866 22:37397037-37397059 GAGCCTAAGCTCCTTCTTGGTGG + Intronic
1184037280 22:41924576-41924598 GAGCCCAGGCTGCAATTAGCTGG + Intergenic
954685700 3:52369067-52369089 GAGCCTAAGCTCCTGCTAGCAGG - Intronic
957909993 3:86608066-86608088 GAGGCTTGGCAGCTTCTAGCTGG - Intergenic
959453542 3:106532169-106532191 GTCCCTAGGCTGCATCCAGCAGG - Intergenic
960867418 3:122215927-122215949 GAGCCAAGGCTGTTTCTTGAGGG + Intronic
961659723 3:128462331-128462353 GGGCCTGGGCTGTTTCTATCAGG - Intergenic
966568351 3:181409090-181409112 GAGCCCACTCTGCTTCAAGCGGG + Intergenic
967126601 3:186429774-186429796 GTGCCTAGGCTGTTTCTAGGTGG - Intergenic
971643593 4:29166766-29166788 GAGGCAAGGCTGCTTCTGACTGG - Intergenic
971726773 4:30324556-30324578 GATCCTGAGCTGCTTCTAGTTGG + Intergenic
973337709 4:48973072-48973094 GAGCCTGGGCTCTTTCTATCCGG - Intergenic
973553098 4:52054676-52054698 GACCATAGGCTGGTTCTGGCCGG - Intronic
975307334 4:72865319-72865341 AAGCCTTGGCTGCTTCCAGGTGG + Intergenic
977808192 4:101328010-101328032 GAACCTAAGCTGATTCCAGCAGG + Intronic
982477252 4:155868456-155868478 GATCCTAAGCTGCTCATAGCAGG + Intronic
989523674 5:42428342-42428364 GTACCTAGGCTGCACCTAGCAGG + Intronic
997948250 5:138221320-138221342 AATCCTGGGCTGCTTCTAGGTGG - Intergenic
1002822378 6:737548-737570 GAGCCTAGGAAGTTTCTAGTGGG + Intergenic
1007475692 6:42118455-42118477 GAGCCCAGGGTGCTGCCAGCAGG + Intronic
1009328198 6:62380458-62380480 GAGTATGGGCTGCTTATAGCTGG + Intergenic
1019456491 7:1130398-1130420 GGGACAAGGCTGCTTCTAGGAGG + Intronic
1019506483 7:1393946-1393968 GAGCCCAGGCTGCTCCCTGCAGG - Intergenic
1019910389 7:4096907-4096929 GAGCCCAGGCTGCCTCTTCCTGG - Intronic
1023840605 7:44095535-44095557 GAACCCAGGCTGCTTCCATCAGG + Intergenic
1028296420 7:89138011-89138033 GAGCCTTGGCAGCTTCTATGTGG + Intronic
1036587518 8:10138082-10138104 GAGCCTTGGCTTCTTGGAGCTGG + Intronic
1038012184 8:23483904-23483926 GGGCCCAGGCTGCATCTGGCTGG - Intergenic
1042040094 8:64580970-64580992 GCCCCTGGGCTGCTTCGAGCCGG + Exonic
1042460996 8:69068367-69068389 AAGCCCAGGCTGGTTCAAGCAGG + Intergenic
1043284898 8:78516342-78516364 GAGCGGAGGCTGCTGCTGGCAGG + Exonic
1045156597 8:99481722-99481744 GTGCCTATACTGCTTCTAACTGG - Exonic
1050061369 9:1713048-1713070 GGGCCTCGGCTGCCTCTGGCTGG - Intergenic
1051884052 9:21871310-21871332 GAGCCTGGTCTGCTTGGAGCTGG - Intronic
1054990982 9:71326738-71326760 GAGCCTAGGGAAATTCTAGCTGG - Intronic
1056790714 9:89623652-89623674 GAGCACAGCCTGCTTCTGGCAGG + Intergenic
1059514002 9:114876069-114876091 AAGCCTTGGCTGCTTCTATGTGG - Intergenic
1059545152 9:115168395-115168417 GAGCATAAGCTGCCTCTAGCGGG + Intronic
1060689961 9:125649004-125649026 CAGCCTAGGCTCCACCTAGCTGG - Intronic
1060869917 9:127031154-127031176 GAGACAAGGCTGATTCTAGAAGG - Intronic
1061296052 9:129677434-129677456 GAGCCTAGGCTGCTTCTAGCAGG - Intronic
1186808099 X:13160467-13160489 GGGCCTGTGCTGCTTCCAGCTGG - Intergenic
1193467694 X:81868419-81868441 GTGCCCAGGCTGCTTATACCAGG + Intergenic
1199155036 X:144536911-144536933 GAGCCTTGGCAGCTTCCAGGTGG - Intergenic