ID: 1061301653

View in Genome Browser
Species Human (GRCh38)
Location 9:129709176-129709198
Sequence CACAAGCACCTTCCCACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 1, 2: 8, 3: 53, 4: 335}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061301653_1061301660 5 Left 1061301653 9:129709176-129709198 CCAGAGGTGGGAAGGTGCTTGTG 0: 1
1: 1
2: 8
3: 53
4: 335
Right 1061301660 9:129709204-129709226 TTCCAGGGGCAGCTCCTGCTGGG No data
1061301653_1061301655 -10 Left 1061301653 9:129709176-129709198 CCAGAGGTGGGAAGGTGCTTGTG 0: 1
1: 1
2: 8
3: 53
4: 335
Right 1061301655 9:129709189-129709211 GGTGCTTGTGCTCCCTTCCAGGG No data
1061301653_1061301662 12 Left 1061301653 9:129709176-129709198 CCAGAGGTGGGAAGGTGCTTGTG 0: 1
1: 1
2: 8
3: 53
4: 335
Right 1061301662 9:129709211-129709233 GGCAGCTCCTGCTGGGTCACTGG No data
1061301653_1061301659 4 Left 1061301653 9:129709176-129709198 CCAGAGGTGGGAAGGTGCTTGTG 0: 1
1: 1
2: 8
3: 53
4: 335
Right 1061301659 9:129709203-129709225 CTTCCAGGGGCAGCTCCTGCTGG No data
1061301653_1061301656 -9 Left 1061301653 9:129709176-129709198 CCAGAGGTGGGAAGGTGCTTGTG 0: 1
1: 1
2: 8
3: 53
4: 335
Right 1061301656 9:129709190-129709212 GTGCTTGTGCTCCCTTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061301653 Original CRISPR CACAAGCACCTTCCCACCTC TGG (reversed) Intronic
902535051 1:17114833-17114855 GCCAAGCTCATTCCCACCTCAGG - Intronic
902700495 1:18168897-18168919 CACCAGCACCTGCTCCCCTCCGG - Intronic
902929069 1:19717612-19717634 CACATGCACCTTCCTGCCTCTGG + Intronic
903047220 1:20573928-20573950 CTCAAGCATCTTCCCGCCTCAGG - Intergenic
903191292 1:21657785-21657807 CACAAGTGCCTTCCCACTTCTGG + Intronic
905850326 1:41269321-41269343 AACAAGTACATTTCCACCTCGGG + Intergenic
905937313 1:41834890-41834912 CCCAAGCACATTCCCACCTCAGG - Intronic
906102227 1:43271006-43271028 CACCAGCCCCCGCCCACCTCGGG + Intronic
906545789 1:46618522-46618544 CACAACCACATTCTCACTTCTGG - Intergenic
907052227 1:51337277-51337299 GCCAGGCACATTCCCACCTCAGG + Intronic
908006425 1:59733488-59733510 AGCAAGCACCTTCACATCTCAGG + Intronic
909680697 1:78288133-78288155 ACCAAGCTCCTTACCACCTCAGG + Intergenic
909979467 1:82081484-82081506 CACCAGCACCCTCCCACCCCAGG - Intergenic
911091899 1:94023796-94023818 AACAACCACCTGCACACCTCGGG + Intronic
911654074 1:100423240-100423262 ACCAAGCTCTTTCCCACCTCAGG + Intronic
912858626 1:113193403-113193425 CACCAAGCCCTTCCCACCTCAGG + Intergenic
914706215 1:150172022-150172044 GCCAAGCTCTTTCCCACCTCAGG + Intergenic
916653531 1:166852255-166852277 CCTAAGCTCCTTACCACCTCAGG + Exonic
916700556 1:167289537-167289559 CACAAGCACCTTACAGCCTTTGG - Intronic
917739183 1:177946515-177946537 CACAAGCCCCTTCCCAGCTGCGG + Exonic
918300552 1:183199858-183199880 CACTAACCCTTTCCCACCTCTGG - Intronic
919920210 1:202162772-202162794 CTCCAGAACCTTCCCACCCCTGG + Intergenic
919987900 1:202688728-202688750 CACAAGCTCCTTCCACCATCAGG - Intronic
920108778 1:203572699-203572721 CAACAGCACCCTGCCACCTCCGG + Intergenic
920620682 1:207543187-207543209 CTCAAGCACCCACCCACCTTGGG + Intronic
920622464 1:207561744-207561766 CTCAAGCACCCACCCACCTTGGG + Intronic
921345860 1:214184575-214184597 AACAAGCTCATTCCTACCTCAGG + Intergenic
922507474 1:226134887-226134909 CACAAACGTCTTCCTACCTCAGG + Intergenic
924252153 1:242143618-242143640 CACCAGGACTTTCCCTCCTCGGG - Intronic
924431881 1:244004262-244004284 CACATGCCCCTCTCCACCTCAGG + Intergenic
924535300 1:244930736-244930758 CAGACGCACCTTCACTCCTCAGG + Intergenic
1063701977 10:8393873-8393895 TCCAAGCAACTTCCCTCCTCAGG + Intergenic
1065013689 10:21442239-21442261 CTCAAGCATCTGCCTACCTCGGG - Intergenic
1065293397 10:24253111-24253133 GACAAGCCCCTTCCTTCCTCTGG - Intronic
1065381544 10:25096105-25096127 CACTAGCACATTCCCAGCTATGG - Intergenic
1065844948 10:29736377-29736399 CCCAAGCATCTTCCCAGCCCTGG - Intronic
1070327632 10:75398954-75398976 CACATGCACATCCCCACCTCGGG - Exonic
1070431002 10:76337524-76337546 CAGGAGCACGCTCCCACCTCAGG - Intronic
1073427854 10:103466915-103466937 GACAAGCCCCTTCCCATCTCAGG + Intergenic
1074584088 10:114749756-114749778 TCCAAGCACATTCCCAACTCAGG + Intergenic
1075335447 10:121605938-121605960 CACAAACACATTCCTACCTTTGG + Intergenic
1075619247 10:123913850-123913872 TCCAAGCACCATCCCTCCTCAGG + Intronic
1076566114 10:131400641-131400663 CACAGGCACCCTCCCCACTCAGG - Intergenic
1076783218 10:132735863-132735885 CACAAGCAGGTCTCCACCTCGGG - Intronic
1076995755 11:296799-296821 CACCAGCACCTCCCTGCCTCAGG - Intergenic
1077368173 11:2169650-2169672 CTCAAACACCTTCACAGCTCGGG + Exonic
1077551225 11:3201145-3201167 CACTGCCACCTTCCAACCTCAGG + Intergenic
1079469598 11:20765632-20765654 CACAAGCTCCTTCCTGCCTTAGG - Intronic
1079591472 11:22188442-22188464 AACAAGCACTTTCCCATCACAGG - Intergenic
1080581834 11:33650749-33650771 CACACGCACCTGCCCCTCTCCGG + Intronic
1080869757 11:36227088-36227110 CACAAACACCTGCCCACTGCCGG - Exonic
1081280603 11:41205092-41205114 CCCAAGCCCTTTCCCACCTCAGG - Intronic
1081608256 11:44541241-44541263 CCCAAGCACCTTCCCACCTCGGG - Intergenic
1081659538 11:44879586-44879608 GGCAAGCACATTCCCGCCTCAGG - Intronic
1082869970 11:57935248-57935270 GACAAGCACCTTCCCCTCTCTGG - Intergenic
1083339622 11:61950572-61950594 ACCAAGCTCATTCCCACCTCAGG - Intronic
1083993294 11:66259446-66259468 CACAAGCTCTTTCCTACCCCAGG - Intronic
1084050417 11:66595840-66595862 GACAAGGAACTTCCCACTTCAGG + Intronic
1084356375 11:68641449-68641471 AAGAAGCACCTGCCCACGTCGGG - Intergenic
1084618180 11:70250608-70250630 CACAAACATCTTCACACCACAGG - Intergenic
1085101717 11:73806336-73806358 TCTAAGCACCTTCCCACCCCAGG + Intronic
1085561987 11:77480144-77480166 GGCAAGCACCCTCCCAACTCAGG + Intergenic
1085782222 11:79419814-79419836 CACAAACTCCTTCCCTTCTCTGG + Intronic
1086210989 11:84318535-84318557 AATAAGCACCTTGCCAGCTCAGG - Intronic
1086950305 11:92884140-92884162 ACCAAGCTCCTTCCCACCCCAGG - Intronic
1088471989 11:110196654-110196676 CTCAGGCCCCTTCCCAACTCAGG + Intronic
1089017338 11:115177093-115177115 TTCAAGCACCTTCTCACCTATGG - Intronic
1089709516 11:120305102-120305124 CCCAAGCATCTACCCAGCTCTGG + Exonic
1089973462 11:122712678-122712700 CACAGGTACCTTCCTACCTGTGG + Intronic
1091494427 12:959964-959986 CCGAAACTCCTTCCCACCTCTGG - Intronic
1091547321 12:1510124-1510146 CCCAAACACCTTCCTCCCTCTGG + Intergenic
1091636124 12:2198179-2198201 CACAAGCACCTTGCTTCCTGAGG - Intronic
1091846186 12:3657849-3657871 CACTTGCACCTTCCAACCCCAGG - Intronic
1092019521 12:5189257-5189279 CTCAAGCACTTCCTCACCTCAGG - Intergenic
1092443658 12:8532640-8532662 CACAAACACTTTACCACCTTCGG - Intergenic
1092465555 12:8728708-8728730 CTCAAGCAGTTTCCCACCTCAGG + Intronic
1094410907 12:30168193-30168215 CTCAAGCACACTGCCACCTCAGG - Intergenic
1094741303 12:33292191-33292213 GTCAAGCACGCTCCCACCTCAGG - Intergenic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1098197469 12:68017160-68017182 GACAAGCTCTTTTCCACCTCAGG - Intergenic
1098348249 12:69528906-69528928 ATCAAGCACCTTCTCACTTCAGG - Intronic
1098600384 12:72324378-72324400 CACCTGCACCTCCCCTCCTCTGG - Intronic
1101208728 12:102514580-102514602 TACCAGCCCCTTCCCACCTCAGG - Intergenic
1101701274 12:107176577-107176599 CACGAGCTCCTTCTCACCGCAGG - Intergenic
1102028152 12:109725152-109725174 GCCAAGCTCCTTCCCAGCTCTGG - Intronic
1102452589 12:113052981-113053003 ACCAAGCGCTTTCCCACCTCTGG + Intergenic
1102477458 12:113197892-113197914 CACAAGCTTGTTCCTACCTCAGG - Intronic
1102506765 12:113388900-113388922 CTCAACCTCATTCCCACCTCTGG + Exonic
1102546366 12:113659581-113659603 AAGAAGCCCCCTCCCACCTCTGG - Intergenic
1102924212 12:116814532-116814554 GCCAAGCACGTTTCCACCTCAGG - Intronic
1103361031 12:120353765-120353787 GCCAAGCTCATTCCCACCTCAGG + Intronic
1103372399 12:120429589-120429611 GCCAAGCCCCTTCCAACCTCAGG - Intergenic
1103520734 12:121535968-121535990 CCCATGCACCTTGGCACCTCCGG + Intronic
1103914934 12:124371268-124371290 ACCAAGCTCATTCCCACCTCGGG + Intronic
1104051336 12:125195829-125195851 GCCAAGCACATTCCCACCTCAGG - Intronic
1104128927 12:125873999-125874021 CACAAGCAGCATCTCACCTGTGG - Intergenic
1104371386 12:128226755-128226777 CACAACTACCTTCTCACCTCCGG - Intergenic
1104943339 12:132404930-132404952 CACGACCCCCTTCCCAGCTCTGG - Intergenic
1105502676 13:20986610-20986632 CACACACCCTTTCCCACCTCTGG - Intronic
1105852782 13:24350426-24350448 CACATTCACTGTCCCACCTCAGG - Intergenic
1107864284 13:44688242-44688264 ACCAAGCTCATTCCCACCTCTGG + Intergenic
1108938813 13:55922723-55922745 CTCAAGAATCCTCCCACCTCAGG + Intergenic
1111337303 13:86840441-86840463 CACCAGCCCCCTGCCACCTCAGG - Intergenic
1112114712 13:96339458-96339480 CTCAAGCACCTTCTCCCCTCAGG - Intronic
1113945788 13:114043438-114043460 AAAAAGCCCCTTCCCAGCTCCGG + Intronic
1114616581 14:24071760-24071782 CACAAGCCCCTGCCTATCTCGGG + Intronic
1114769890 14:25417070-25417092 TACAAGCTCCTTCCTTCCTCAGG + Intergenic
1115426585 14:33267757-33267779 CACATGCAGATCCCCACCTCAGG - Intronic
1118439456 14:65799573-65799595 CTCAAGCACCATTCCACCGCAGG - Intergenic
1118733405 14:68685038-68685060 CACCACTACCTTCCCACCGCTGG - Intronic
1118735248 14:68696445-68696467 TCCATGCACCTTCCCACCGCAGG - Intronic
1118837595 14:69487627-69487649 CAAGGGCACCTTCCCACCCCAGG - Intronic
1119357761 14:74021025-74021047 CACATCCACTTTCCTACCTCTGG - Intronic
1119551911 14:75521081-75521103 CTCAAGCACACTTCCACCTCAGG + Intergenic
1119617164 14:76106519-76106541 GCCAAGCATCTTCCCACCCCAGG + Intergenic
1119935114 14:78585280-78585302 ACCAAGCACATTCCCACCTCAGG - Intronic
1119972004 14:78981337-78981359 CACATGCACATTCCCCACTCTGG + Intronic
1120816826 14:88869619-88869641 GACAAGCACGTTCCCCTCTCAGG + Intronic
1121818597 14:96947075-96947097 GCCAAGCTCTTTCCCACCTCAGG - Intergenic
1124006151 15:25797123-25797145 CCCAAGTCCCTTCCAACCTCTGG + Intronic
1124651592 15:31478045-31478067 CACAGGCACCCTCCTGCCTCAGG - Exonic
1125802729 15:42464624-42464646 CTCAAGCATCCTCCCACCTCAGG + Intronic
1125957478 15:43800314-43800336 AACACGCACCCACCCACCTCAGG - Intronic
1127300073 15:57644247-57644269 CACCAGCAGCTTCCCACCTCAGG - Intronic
1128127518 15:65204006-65204028 CACAGGCACATTCCTGCCTCAGG - Intronic
1128577413 15:68785643-68785665 CAAAAGCAGCTTCCCGCCCCAGG + Intronic
1129172329 15:73815862-73815884 TCCAAGCTCCTTGCCACCTCTGG + Intergenic
1129774687 15:78228787-78228809 TACAAGCTCCATCCCACCTCGGG + Intronic
1130399113 15:83532707-83532729 CACCAGCAGCCTCCCATCTCTGG - Intronic
1131144105 15:90000712-90000734 CACACCCAGCTTGCCACCTCTGG + Intergenic
1132067252 15:98742400-98742422 CACAAGCATCTCCACACCTCAGG - Intronic
1132993264 16:2808376-2808398 CCCAGGTTCCTTCCCACCTCAGG - Intergenic
1133074927 16:3272670-3272692 TAGAAGCACTTTCACACCTCAGG + Intronic
1133729363 16:8566717-8566739 CAGAAGCTTCTTCCCACCTCAGG + Intergenic
1133778739 16:8919850-8919872 CACCAGCACCTTGCCACTCCAGG + Intronic
1134121131 16:11586133-11586155 CACCAGCACCTACCCAGCACCGG + Intronic
1134505810 16:14805999-14806021 GCCAAGCTCCTTCCCACCTCTGG + Intronic
1134574770 16:15322940-15322962 GCCAAGCTCCTTCCCACCTCTGG - Intergenic
1134727674 16:16433526-16433548 GCCAAGCTCCTTCCCACCTCTGG + Intergenic
1134939762 16:18278301-18278323 GCCAAGCTCCTTCCCACCTCTGG - Intergenic
1135349945 16:21720356-21720378 AAAAAGCACCTTCTCAACTCTGG + Intronic
1135498049 16:22969789-22969811 CACAACCAACTTCCCATCTCAGG + Intergenic
1135924459 16:26680342-26680364 CACAAGTTGCTTCCCATCTCTGG - Intergenic
1136190832 16:28614105-28614127 CCCCTGCACCTGCCCACCTCAGG + Intronic
1136318282 16:29466593-29466615 CCCCTGCACCTGCCCACCTCAGG - Exonic
1136412986 16:30087682-30087704 CACAGGCACAGCCCCACCTCAGG + Intronic
1136432857 16:30205942-30205964 CCCCTGCACCTGCCCACCTCAGG - Exonic
1136630825 16:31488403-31488425 CACACGCGCCTGCACACCTCAGG - Exonic
1137369183 16:47888838-47888860 CCCAAGCATCTTCCTGCCTCAGG + Intergenic
1137526661 16:49242245-49242267 CACCAGCACTTCCCCAACTCAGG + Intergenic
1137552970 16:49453131-49453153 CACACACACCATCCCACCCCAGG + Intergenic
1137572157 16:49573844-49573866 GACAAGCCCCTTCCCCTCTCTGG + Intronic
1137830785 16:51540979-51541001 CTCAAGCAACCTCCAACCTCAGG - Intergenic
1139460129 16:67115425-67115447 GTCAAGCTCCTTCTCACCTCAGG - Intronic
1140713293 16:77697891-77697913 GCCAAGCTCTTTCCCACCTCTGG - Intergenic
1141017847 16:80467076-80467098 TACTAGCACCTTACCTCCTCTGG - Intergenic
1141065550 16:80910936-80910958 CCCAAACTCCTTCCCACCTCAGG + Intergenic
1141921591 16:87139175-87139197 CCCAAGCCCATTCCCACCTTTGG + Intronic
1143106331 17:4532300-4532322 TCCCTGCACCTTCCCACCTCTGG + Intronic
1143811062 17:9472255-9472277 CACAAGCACATTCCCAGCCGAGG - Intronic
1144702767 17:17349672-17349694 CTGAAGCAGCTGCCCACCTCGGG - Intergenic
1144959098 17:19034806-19034828 CCCAATCACATTCCCACCTCAGG + Intronic
1144976061 17:19139718-19139740 CCCAATCACATTCCCACCTCAGG - Intronic
1145786681 17:27598236-27598258 CACAGTCACCTTCCTTCCTCTGG - Intronic
1145839103 17:27978656-27978678 CAGAAGCACCATCCCATCTCTGG - Intergenic
1146456111 17:33011096-33011118 CAGAATAACCTTCCCATCTCAGG - Intergenic
1147129106 17:38395624-38395646 CACACACACCTTCCTCCCTCTGG - Intronic
1147776712 17:42907067-42907089 ACCAAACACGTTCCCACCTCAGG - Intronic
1148443142 17:47722061-47722083 CCCAGGCCCCTTCCCTCCTCAGG + Intergenic
1148810200 17:50285414-50285436 CCCAAGCTCCTTCCCTCCTCAGG - Intergenic
1149285398 17:55158513-55158535 CACCACCATCTTCCCAACTCTGG - Intronic
1149637369 17:58181667-58181689 ACCAAGCTCATTCCCACCTCAGG - Intergenic
1150201884 17:63365679-63365701 AACTTGCACTTTCCCACCTCTGG + Intronic
1151248399 17:72814530-72814552 CTCAGGCACCTTCTCACCTCGGG - Intronic
1151257270 17:72887881-72887903 CACAAGCACATTCACACTTAGGG - Intronic
1157402566 18:47400594-47400616 CACAATCATCTTCCCACCCAGGG + Intergenic
1157402597 18:47400720-47400742 CACAATCACCCTCCCACCCAGGG + Intergenic
1157402693 18:47401095-47401117 CACAATCATCTTCCCACCCGGGG + Intergenic
1157402723 18:47401220-47401242 CACAATCACCCTCCCACCCAGGG + Intergenic
1157402898 18:47401886-47401908 CACAATCATCTTCCCACCCGGGG + Intergenic
1157402929 18:47402012-47402034 CACAATCATCTTCCCACCCGGGG + Intergenic
1157402951 18:47402096-47402118 CACAATCATCTTCCCACCCGGGG + Intergenic
1157402961 18:47402138-47402160 CACAATCATCTTCCCACCCGGGG + Intergenic
1157402972 18:47402180-47402202 CACAATCATCTTCCCACCCGGGG + Intergenic
1157403117 18:47402724-47402746 CACAATCATCTTCCCACCCGGGG + Intergenic
1157403148 18:47402849-47402871 CACAATCATCCTCCCACCTGGGG + Intergenic
1158300455 18:56046558-56046580 CACAAGGACTTTCCAGCCTCTGG - Intergenic
1158543454 18:58376870-58376892 CACAAGCCCCTTCCTGCCTCAGG + Intronic
1159664335 18:71139741-71139763 CACAAGCACCCCACCACTTCCGG + Intergenic
1161705548 19:5819179-5819201 GACAAGTCACTTCCCACCTCTGG + Intergenic
1161734096 19:5979734-5979756 CACAAGCTCATTCCAACCTAAGG + Intergenic
1162581569 19:11534361-11534383 CCCAAACATGTTCCCACCTCAGG - Intergenic
1162766516 19:12923081-12923103 AAAAAGCACATTCCCACCTCTGG + Intronic
1162896231 19:13766052-13766074 CACAGTCACCTTGCCACCGCTGG - Exonic
1163211615 19:15845107-15845129 GGCAATCATCTTCCCACCTCGGG - Intergenic
1163549472 19:17957584-17957606 GCCAAGCTCATTCCCACCTCAGG - Intronic
1163703514 19:18799011-18799033 ATCAAGCACATACCCACCTCTGG - Intergenic
1164418639 19:28067516-28067538 CACAAGCACCACCCCCCATCAGG + Intergenic
1164865433 19:31600706-31600728 CACAAGCATCTTCCCAGCCTGGG + Intergenic
1165119126 19:33547807-33547829 CAGAGGCACATGCCCACCTCAGG + Intergenic
1165714799 19:38037392-38037414 GTCAAGCTCCTTCCCACGTCCGG - Intronic
1165757238 19:38301051-38301073 CACAGGCACATTCCTGCCTCAGG + Intronic
1166886091 19:45961876-45961898 CACAGGCACAGTCCCACTTCAGG - Intronic
1167122969 19:47529924-47529946 CACAAGCTCCTTACTCCCTCAGG + Intronic
1167310970 19:48737795-48737817 CACAAGCCCCGCCCCACCACAGG + Intronic
1167637495 19:50663369-50663391 CTCCAGCACTGTCCCACCTCAGG + Intronic
1168073554 19:53965934-53965956 CACAGCCACACTCCCACCTCAGG - Intronic
926596723 2:14797671-14797693 CACACACCCCTTCCCACCTCAGG + Intergenic
926837150 2:17035787-17035809 ACCAAGCACATTTCCACCTCAGG - Intergenic
928256015 2:29723247-29723269 ACCAAGCACATTCCCACCCCAGG + Intronic
928270645 2:29851799-29851821 CCAAAGCACCTTCACACCTGTGG + Intronic
928504730 2:31939016-31939038 CTCAAGCATCTTCCCACCTCAGG + Intronic
928870305 2:35968366-35968388 GCCAAGCACATTTCCACCTCAGG + Intergenic
932432906 2:71686174-71686196 CACCCGCACCCTCCCACCTGGGG - Intronic
932694096 2:73939652-73939674 CAGAAGCACCATGCCTCCTCAGG + Intronic
932740424 2:74286856-74286878 CACCAGCACGTTTCCACCACAGG - Intronic
932746052 2:74334372-74334394 CCCAGGCTCATTCCCACCTCAGG + Intronic
933633283 2:84680575-84680597 CCCACACTCCTTCCCACCTCAGG - Intronic
933773558 2:85758656-85758678 CACCTGCACCTCCCCACCTGCGG - Intronic
934659671 2:96136556-96136578 CCCAGGCACCATCCCACCCCTGG - Intronic
935671123 2:105558042-105558064 AACAAGCAGCATCCCACCTTTGG + Intergenic
940567619 2:155387806-155387828 GAGAAGCATCCTCCCACCTCAGG + Intergenic
940807291 2:158202212-158202234 CACAATCACTTTCCCACTTTGGG + Intronic
944852938 2:203738586-203738608 CACAGGCATGTTCCTACCTCAGG + Exonic
945934586 2:215890138-215890160 GACAATCAATTTCCCACCTCAGG + Intergenic
948754528 2:240151162-240151184 CCAGAGCACCCTCCCACCTCTGG + Intergenic
1168788690 20:561529-561551 ACCAAGCACATTCCCACCTCAGG - Intergenic
1168845409 20:941165-941187 GACAAGCTCCTTCCAGCCTCAGG - Intergenic
1168997866 20:2146184-2146206 CTCAAACACTTGCCCACCTCAGG + Exonic
1169131087 20:3166718-3166740 CCCAAGCTCCTGGCCACCTCTGG - Exonic
1169277511 20:4243704-4243726 TACACGCACCTCCGCACCTCTGG + Intronic
1169464355 20:5824182-5824204 CATAAGCTCACTCCCACCTCCGG + Intronic
1169508532 20:6239767-6239789 CACCAACAGCTTCCCACCTCAGG + Intergenic
1170828138 20:19814690-19814712 CTCAAGCATCCTCCCACCTTAGG + Intergenic
1172098211 20:32470880-32470902 CACTGGCACCTCCCCAACTCTGG + Intronic
1173583875 20:44166987-44167009 CACACTCGCCTTCCCACCTTGGG + Intronic
1173915896 20:46708850-46708872 CATAAGCTCCTTCCCACCCCGGG + Intergenic
1174051401 20:47769940-47769962 CTCAGGCATCTTCCTACCTCAGG - Intronic
1174083812 20:47990381-47990403 CACAAGCACCATCCTGCCTCAGG - Intergenic
1174088197 20:48025284-48025306 CACGAGCCCCCTCCCACCTTGGG - Intergenic
1174110710 20:48195981-48196003 ACTAAGCACATTCCCACCTCAGG + Intergenic
1174127807 20:48320106-48320128 CACGAGCCCCCTCCCACCTTGGG + Intergenic
1174170654 20:48616232-48616254 ATCAAGCACATGCCCACCTCAGG - Intergenic
1174407571 20:50312130-50312152 AACAAGCCCTTTCCCACCTCAGG + Intergenic
1175004432 20:55667148-55667170 CCCAGGCTCATTCCCACCTCTGG - Intergenic
1175295891 20:57908474-57908496 CAGAAGCCCCTTCACATCTCAGG - Intergenic
1175464002 20:59177408-59177430 GCCAGGCACATTCCCACCTCAGG + Intergenic
1175589874 20:60180854-60180876 CACAAGCCCGTTCCGACCACGGG - Intergenic
1176061405 20:63174446-63174468 ACCAAGCATCTGCCCACCTCTGG + Intergenic
1178878296 21:36429280-36429302 CACAAGCACCTACCCTTCCCAGG - Intergenic
1180713448 22:17855752-17855774 CAGAGGCACATTCCCAACTCTGG + Intronic
1180922327 22:19527346-19527368 GCCGAGCCCCTTCCCACCTCTGG - Exonic
1181009461 22:20032091-20032113 CATCAGCATCTTCCCACCTGTGG + Intronic
1181088399 22:20455641-20455663 CACAAGGAACTTTCCACCCCCGG + Intronic
1181863877 22:25840290-25840312 AGCATGCACATTCCCACCTCTGG + Intronic
1181953437 22:26571226-26571248 CACAAGCACCCTCCCTCCTCTGG + Intronic
1182007858 22:26976090-26976112 CACATGCAACTCCCCACCACAGG - Intergenic
1182012095 22:27009627-27009649 AACAGGCACATGCCCACCTCAGG - Intergenic
1182017855 22:27055896-27055918 CCCATGCTCATTCCCACCTCAGG - Intergenic
1182468685 22:30533619-30533641 CACCAGCTCATTCCCACCTCAGG + Intronic
1182760952 22:32721980-32722002 AACAAGCTCCTTCCTACCACAGG - Intronic
1182896074 22:33860607-33860629 CACCACCACCTTCACAGCTCAGG - Intronic
1184085647 22:42262001-42262023 AGCAAGCTCTTTCCCACCTCTGG - Intronic
1184187141 22:42872300-42872322 CACAGGCCCCTGCCCACCCCTGG - Intronic
1184393232 22:44217786-44217808 CTCAAGCATCCTCTCACCTCAGG + Intronic
1184581678 22:45422229-45422251 CAGGAGCACCTTCCCACGTGTGG - Intronic
949090895 3:27801-27823 CACCACCACCCTCCCACCCCCGG + Intergenic
949278244 3:2313595-2313617 CAGAATCACCACCCCACCTCCGG - Intronic
949341285 3:3033652-3033674 CACCATCACCTTCCCTCCTGAGG + Intronic
949879464 3:8650019-8650041 ACCAAGCACATTCCCACCTCAGG + Intronic
950863149 3:16168382-16168404 CAGAAATAGCTTCCCACCTCCGG - Intergenic
952037016 3:29214953-29214975 CCCAAGCACTATCCCAACTCAGG - Intergenic
953300337 3:41768164-41768186 CAAAACCACCTCCCCAGCTCTGG + Intronic
953796809 3:45992232-45992254 CACCAGCACCTCCCCTCCCCAGG - Intronic
955353083 3:58208446-58208468 CAAAAGCACCTACCTACCTCAGG - Intronic
955773080 3:62405645-62405667 CACACGCAGCCTCCCACCCCAGG + Intronic
955873319 3:63462884-63462906 CACAAGCACCTTCCCCTTACAGG - Intronic
958580063 3:96007177-96007199 TAGAAGCACCTGCCCAGCTCAGG - Intergenic
961696966 3:128712054-128712076 ACCAAGCTCCTTCCCACCTTGGG - Intergenic
961824497 3:129592041-129592063 CACAAGCTCGTTCCTGCCTCAGG + Intronic
962251012 3:133836156-133836178 CACCAGCAGCTTCCCCCCTTGGG - Intronic
962408897 3:135124146-135124168 ACCAAGTACATTCCCACCTCAGG + Intronic
962742952 3:138376157-138376179 ACCAAGCACCTTCCCATCTTGGG + Intronic
962960752 3:140309302-140309324 CCCAAGCATCTTGCCACCTCTGG - Intronic
963260303 3:143185633-143185655 GACAAGCACCCTCCTACCACAGG - Intergenic
965707842 3:171527002-171527024 AACAAGCACTTTCCCAGCTGAGG + Intergenic
966850357 3:184161096-184161118 GCCAAGCACATTCCCAGCTCTGG + Intronic
968808471 4:2789542-2789564 CGCAGACACATTCCCACCTCAGG - Intergenic
969230306 4:5826204-5826226 CACTACCACCTACCCACCCCCGG + Intronic
969455331 4:7296975-7296997 CACCAGCATCTTCCGGCCTCTGG + Intronic
969689327 4:8695475-8695497 CACATGCACCCTCCTTCCTCTGG - Intergenic
969881157 4:10175213-10175235 CACAAGCACAGACGCACCTCTGG - Intergenic
970416405 4:15862062-15862084 CACAAGCAGCCTTGCACCTCTGG - Intergenic
971173566 4:24259314-24259336 CGCAAGCACATTCCCACCTCAGG + Intergenic
971370589 4:26015698-26015720 CACAAGCCCCTGGGCACCTCAGG - Intergenic
972854178 4:43086375-43086397 CACCAGCACGTTCCCAGCTAAGG - Intergenic
973771366 4:54210027-54210049 ATCAAGCTCTTTCCCACCTCTGG - Intronic
973990285 4:56398884-56398906 CTCAAGCAACCTCCTACCTCAGG + Intronic
977176004 4:93820083-93820105 ACCAAGCGTCTTCCCACCTCAGG - Intergenic
978752722 4:112270659-112270681 AACAAACTCTTTCCCACCTCAGG - Intergenic
979396726 4:120197936-120197958 CCCCAGCACATTCCCAGCTCTGG + Intergenic
979637834 4:122977802-122977824 CAGAAGGACCTACCCACTTCAGG - Intronic
981335206 4:143561727-143561749 AACAAGCACTTTCCCATCACAGG - Intergenic
981413910 4:144465378-144465400 CACACGCAGCTTCCCAATTCTGG - Intergenic
982359249 4:154501084-154501106 CACTAGCAGGTTCCCACCTCTGG - Intergenic
983033457 4:162833139-162833161 CACTGTCAGCTTCCCACCTCTGG + Intergenic
984935643 4:184887669-184887691 CTCAACCCCCTTCTCACCTCTGG + Intergenic
985636626 5:1038847-1038869 CACAAGCTGCTTCCCCCCACCGG - Exonic
986255633 5:6100567-6100589 CACATGGACCTCCCCACCTTAGG + Intergenic
986255844 5:6101211-6101233 CACATGGACCTCCCCACCTTAGG + Intergenic
988801930 5:34704077-34704099 CAAAAGCACCTTCCCACCTTAGG + Intronic
990182121 5:53173076-53173098 GACAAGCACTTTCCCAGTTCAGG - Intergenic
994578987 5:101614557-101614579 CACAGGCACCTTTGCCCCTCAGG + Intergenic
996345947 5:122488722-122488744 GACGAGCTCATTCCCACCTCAGG - Intergenic
999266172 5:150268336-150268358 ACCAAGCTCCTTCCCACCTCAGG + Intronic
1000082522 5:157861423-157861445 AACAACCACCTTCCCTCCCCTGG + Intergenic
1000151784 5:158509572-158509594 ATCAAGCTCCTTCCCATCTCAGG - Intergenic
1004554778 6:16685060-16685082 CACACACACCCTCCCACTTCTGG + Intronic
1005792972 6:29326245-29326267 GTCACACACCTTCCCACCTCTGG - Intergenic
1006025260 6:31142743-31142765 CACGAGCACCTTCCCTTGTCTGG - Intronic
1006430849 6:33994882-33994904 TACAAGTAGATTCCCACCTCAGG - Intergenic
1006584049 6:35094039-35094061 AACAAGCAGCCTCCCACCTCAGG + Intergenic
1007348374 6:41250261-41250283 GCCAAGCACCTTCTGACCTCAGG - Intergenic
1007406746 6:41639820-41639842 GACAAGCTCCTTCCCTTCTCTGG + Intronic
1007998447 6:46334006-46334028 CAAAAACACATTCTCACCTCAGG + Intronic
1010064576 6:71667031-71667053 GTCAAGCACATTCCCATCTCAGG + Intergenic
1011726598 6:90216057-90216079 CACAACCACCTTAACACATCAGG + Intronic
1011954352 6:93007246-93007268 CAAAAGCTTCTTCCAACCTCTGG + Intergenic
1018413818 6:163583750-163583772 CACACCCACATTCCCACCTCTGG + Intergenic
1018608551 6:165624169-165624191 CACAAGAACTGTCCCTCCTCTGG + Intronic
1019005751 6:168795099-168795121 CACAACCACAGTCCCACCTTCGG - Intergenic
1019637510 7:2083919-2083941 CCCAAGCTCCTCCCCACCCCAGG - Intronic
1020944170 7:14580150-14580172 GTCAAGTGCCTTCCCACCTCTGG + Intronic
1021195779 7:17672926-17672948 AACAAGCACATTCCCAGCTGAGG + Intergenic
1021259299 7:18433676-18433698 CACACACACCTCCCCACCCCAGG + Intronic
1021348761 7:19562082-19562104 AACAAGCTCCTTTCCAACTCTGG - Intergenic
1022517620 7:30986088-30986110 GCCGAGCTCCTTCCCACCTCGGG - Intronic
1022560638 7:31345713-31345735 CTCAGGCACCGTCCCACCTTAGG + Intergenic
1024987879 7:55211793-55211815 CACCATCACCATCGCACCTCAGG + Intronic
1028207565 7:88034133-88034155 CACTAGCACATTCCCAGCTATGG - Intronic
1028233767 7:88335992-88336014 CTCAAGCACACTCCCACCTCAGG - Intergenic
1030293352 7:107893696-107893718 CACAAGCTAAGTCCCACCTCAGG - Intronic
1032046187 7:128610609-128610631 CTCAAGCATCTTCCCACCTCAGG - Intergenic
1032415508 7:131732588-131732610 GCCAAGCACTTTCCCACCTCCGG + Intergenic
1034041681 7:147884157-147884179 CCCAAGCACATTCCCACTTTAGG - Intronic
1038035959 8:23687055-23687077 CAGAATAACCTTCCCATCTCAGG - Intergenic
1039409794 8:37343124-37343146 CACAAGAAGTTTCCCACTTCTGG - Intergenic
1043639915 8:82439151-82439173 CACACACCCTTTCCCACCTCTGG + Intergenic
1045102573 8:98860419-98860441 ACCAAGCTCCTTCCCACCTTAGG - Intronic
1046639149 8:116706321-116706343 GTCAAGCTCATTCCCACCTCAGG + Intronic
1047825761 8:128572955-128572977 CACAAGCACTCTCCTGCCTCAGG - Intergenic
1048571136 8:135657850-135657872 CCCAAGCATGCTCCCACCTCAGG - Intergenic
1049206417 8:141365695-141365717 CAGACTCTCCTTCCCACCTCTGG - Intronic
1050271496 9:3950505-3950527 ACCATGCCCCTTCCCACCTCAGG + Intronic
1050272346 9:3959626-3959648 CATAAAGCCCTTCCCACCTCAGG + Intronic
1052159328 9:25235585-25235607 CTCTAGCACTTTCACACCTCCGG + Intergenic
1052159330 9:25235602-25235624 CTCCGGCACCTTCACACCTCTGG + Intergenic
1052712125 9:32069804-32069826 CACCATCCCCTTTCCACCTCTGG + Intergenic
1052990420 9:34516167-34516189 CCCAAGCTGGTTCCCACCTCAGG - Intronic
1053100172 9:35365039-35365061 CACAAGTACCTTCACACTTAGGG - Intronic
1056799355 9:89680885-89680907 CACTAGCACCTTCCAACCTCGGG - Intergenic
1057207617 9:93183188-93183210 CACAAGCATCTTTTCATCTCTGG + Intergenic
1057389805 9:94633551-94633573 CAGAAACACTTTCCCACCTCAGG + Intronic
1057945538 9:99324826-99324848 AACAAGCTCCTTCCTGCCTCAGG - Intergenic
1058864320 9:109147395-109147417 GGCAAGCCCCTTCCCATCTCAGG - Intronic
1061098103 9:128471821-128471843 TACAAACACTTTCCCACCTTGGG - Intronic
1061301653 9:129709176-129709198 CACAAGCACCTTCCCACCTCTGG - Intronic
1062011249 9:134268014-134268036 CACAAGCACCTCACCACGTGAGG + Intergenic
1062182880 9:135200238-135200260 CACAAGCCCCTGCCCAGCCCTGG + Intergenic
1062200064 9:135297884-135297906 GGCAAGCCCCTTCCCACCTGTGG - Intergenic
1062595583 9:137297619-137297641 CACAATTTTCTTCCCACCTCTGG - Intergenic
1186642638 X:11472512-11472534 ACCAAGCTCCTTACCACCTCAGG - Intronic
1186898639 X:14030133-14030155 CAGAAGCACCGTCCGACCCCCGG - Intergenic
1187352841 X:18537026-18537048 CAGAAGCTTCTTCCCACCACAGG + Intronic
1187410808 X:19049080-19049102 ACCAAGCATATTCCCACCTCAGG + Intronic
1189092488 X:38101232-38101254 CACAAGCCCCTTCTCCCCTCGGG - Intronic
1189327015 X:40118806-40118828 CCCAAGCAGCCTCCCACCTGAGG - Intronic
1189591559 X:42517865-42517887 CACAAGCAGCTGCCACCCTCAGG + Intergenic
1190119223 X:47646903-47646925 GGCAGGCACCATCCCACCTCAGG + Intronic
1190460488 X:50668375-50668397 AACAAGCAGCCTCCCTCCTCAGG + Intronic
1190501607 X:51084473-51084495 GTCAAGCTCTTTCCCACCTCAGG - Intergenic
1190894588 X:54604568-54604590 CCCAAGCTCATTCCCACCTCAGG - Intergenic
1190939454 X:55026504-55026526 CTCAAGCTCCTTCTCCCCTCTGG - Intronic
1191590124 X:62873625-62873647 CACACACACCTACCCACCCCTGG + Intergenic
1192103926 X:68294733-68294755 CACAATCACATCCCTACCTCTGG + Intronic
1192173639 X:68872449-68872471 CACAGGCTCCTTCCCTCCTCTGG - Intergenic
1192198846 X:69050677-69050699 CACAATCTCATTCCCACTTCAGG + Intergenic
1192236631 X:69300342-69300364 CACAAGTGCCTTCCCAGCTCTGG - Intergenic
1193144887 X:78066420-78066442 CACAAGCACATTCTCTCCTTAGG + Intronic
1194806823 X:98339342-98339364 CACACACACTTTCCAACCTCTGG + Intergenic
1195304151 X:103562640-103562662 GCCAAGCTACTTCCCACCTCAGG + Intergenic
1195402104 X:104472052-104472074 GTCAAGCTTCTTCCCACCTCTGG - Intergenic
1196609431 X:117695011-117695033 CACCACCACTTTCCCACCCCAGG + Intergenic
1196865189 X:120065023-120065045 ACCAAGCTCCTTCCCACCTTGGG - Intergenic
1196877904 X:120171257-120171279 ACCAAGCTCCTTCCCACCTTGGG + Intergenic
1197406960 X:126065305-126065327 CACCAGCACCCTGCCACATCTGG + Intergenic
1199534155 X:148883186-148883208 CACAAGCACATTTCTACATCTGG + Intronic
1200215550 X:154366639-154366661 CACAGGCTCCTTCCCACTGCAGG - Exonic