ID: 1061302078

View in Genome Browser
Species Human (GRCh38)
Location 9:129711133-129711155
Sequence AGCCAGCCCCAAGATCCTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061302078_1061302085 11 Left 1061302078 9:129711133-129711155 CCACGAGGATCTTGGGGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1061302085 9:129711167-129711189 GGTGACTCAGGCAGCAGTGTGGG No data
1061302078_1061302079 -10 Left 1061302078 9:129711133-129711155 CCACGAGGATCTTGGGGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1061302079 9:129711146-129711168 GGGGCTGGCTTCCCATGCCGAGG No data
1061302078_1061302086 12 Left 1061302078 9:129711133-129711155 CCACGAGGATCTTGGGGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1061302086 9:129711168-129711190 GTGACTCAGGCAGCAGTGTGGGG No data
1061302078_1061302087 18 Left 1061302078 9:129711133-129711155 CCACGAGGATCTTGGGGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1061302087 9:129711174-129711196 CAGGCAGCAGTGTGGGGAAGTGG No data
1061302078_1061302084 10 Left 1061302078 9:129711133-129711155 CCACGAGGATCTTGGGGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1061302084 9:129711166-129711188 AGGTGACTCAGGCAGCAGTGTGG No data
1061302078_1061302080 -1 Left 1061302078 9:129711133-129711155 CCACGAGGATCTTGGGGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1061302080 9:129711155-129711177 TTCCCATGCCGAGGTGACTCAGG No data
1061302078_1061302088 30 Left 1061302078 9:129711133-129711155 CCACGAGGATCTTGGGGCTGGCT 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1061302088 9:129711186-129711208 TGGGGAAGTGGCTAAGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061302078 Original CRISPR AGCCAGCCCCAAGATCCTCG TGG (reversed) Intronic
900519350 1:3098195-3098217 ATCCAGCCCCATGAGCCTGGAGG - Intronic
901049636 1:6419809-6419831 AGGCAGCCCCATGCTCCGCGGGG + Exonic
902502786 1:16922014-16922036 CGCCAGCCCCAAGCTCATGGGGG - Exonic
906320682 1:44813569-44813591 AGCCCGGCCCACGGTCCTCGGGG + Intronic
909652373 1:77990056-77990078 AGCCATCCCCAAGAGACTGGGGG + Intronic
912508862 1:110174908-110174930 AGCCATCCCCACGATGCTCCAGG - Exonic
912513018 1:110201299-110201321 ATCCAGCCCCAGAATCCTGGAGG + Exonic
912696277 1:111844502-111844524 AGCTGGCCCCAGGATCCACGGGG + Intronic
918038626 1:180898605-180898627 AGCGATTCCCAAGATCCTGGGGG - Intergenic
919781281 1:201222737-201222759 AGTCTGTCCCAAGTTCCTCGTGG + Exonic
920250061 1:204617543-204617565 AGCCAGGCCCAGGAGCCTCTGGG + Exonic
921643214 1:217581107-217581129 CACCAGCCCCAAGATCCGCTGGG + Intronic
923988574 1:239409192-239409214 AGCAAGCCCCAAGCTCCAAGAGG - Intronic
924642671 1:245849019-245849041 ACCCAGCCCATAGATGCTCGTGG - Intronic
1070143930 10:73760107-73760129 AGCCAGGCCCAAGGTCATCCTGG + Exonic
1070933246 10:80275233-80275255 AGCCAGCCCCTAGATGCTGGAGG + Intronic
1076426328 10:130369998-130370020 TGACAGCCCCAGGATCCTGGAGG - Intergenic
1077228806 11:1449653-1449675 AGCCCGGGCCAAGAGCCTCGAGG - Intronic
1081189074 11:40081052-40081074 AGCAAGCCCCAAGTTCCCAGTGG - Intergenic
1081779306 11:45699008-45699030 AGCCAGACCCAAGGCCCTGGGGG - Intergenic
1083214007 11:61207266-61207288 AGCCAACCCCAAGGGCCTCCTGG - Intronic
1083216891 11:61226095-61226117 AGCCAACCCCAAGGGCCTCCTGG - Intronic
1083219773 11:61244921-61244943 AGCCAACCCCAAGGGCCTCCTGG - Intronic
1084473547 11:69376558-69376580 ACACCACCCCAAGATCCTCGAGG - Intergenic
1089489133 11:118870744-118870766 ATCCAGCTCCACGATCCTCCAGG - Intergenic
1089610191 11:119664607-119664629 AGCCAGCCCCGAACTCCTGGGGG - Exonic
1091131836 11:133153063-133153085 AGCCGCCCACAAGACCCTCGCGG - Intronic
1091166674 11:133482451-133482473 AGGCAGCACCCAGATCCTCCAGG - Intronic
1091586739 12:1821180-1821202 AGACAGCCCCAAGAAACTCGGGG + Intronic
1096472430 12:51888067-51888089 GACCAGCCCCAAGATCCTCCGGG - Exonic
1096693772 12:53336145-53336167 AGCCAGCCCCAGGTTCCCCCAGG - Exonic
1098627755 12:72693527-72693549 AGCCTACCCCAGCATCCTCGGGG + Intergenic
1101222242 12:102653684-102653706 AGCCAGTCCCCAGATCTGCGGGG - Intergenic
1103110756 12:118276228-118276250 AGCCAGCACCAAGGTGCTGGTGG + Intronic
1103546402 12:121704787-121704809 AGCCAGCCTCAAAAACCTCAGGG + Intergenic
1108071104 13:46629538-46629560 AGCAAGCCCCAGCATCCTCAGGG + Intronic
1112884175 13:104147994-104148016 AGCCAGCACCAAGATCCCATGGG + Intergenic
1112954900 13:105044525-105044547 TGCCAGCCCCAAGATACCCCAGG - Intergenic
1113786177 13:113003247-113003269 AGCCAACCCCAAAACCCACGGGG - Intronic
1119430673 14:74566493-74566515 TGCCAGCACCCAGATCCTCAGGG - Intronic
1119554126 14:75540371-75540393 AGCCACCCCCAAGCTGCTTGCGG + Intronic
1120457746 14:84754349-84754371 AGCCAGGCCCAGGGTCCTTGTGG + Intergenic
1120997654 14:90428598-90428620 ACCCCGCCCCAAGATCCTTGTGG + Intergenic
1121319389 14:92982195-92982217 AGTCAACCCCAAGATCCCTGTGG + Intronic
1121928940 14:97954538-97954560 AGCCAGCCTCAAGGATCTCGAGG - Intronic
1123041068 14:105490452-105490474 AGACAGCCCCACGTTCCTCCCGG + Intronic
1123473735 15:20572437-20572459 GGGCAGCCCCAAGCTCCTGGGGG - Intergenic
1123490960 15:20782609-20782631 ATTCAGCCCCAACATCCTCCTGG + Intergenic
1123547462 15:21351700-21351722 ATTCAGCCCCAACATCCTCCTGG + Intergenic
1123644274 15:22427916-22427938 GGGCAGCCCCAAGCTCCTGGGGG + Intergenic
1123734035 15:23167448-23167470 GGGCAGCCCCAAGCTCCTGGGGG - Intergenic
1124284538 15:28388759-28388781 GGGCAGCCCCAAGCTCCTGGGGG - Exonic
1124298159 15:28522855-28522877 GGGCAGCCCCAAGCTCCTGGGGG + Exonic
1124515933 15:30367495-30367517 CGCCAGCACCATGATCATCGTGG - Exonic
1124726987 15:32163236-32163258 CGCCAGCACCATGATCATCGTGG + Exonic
1127041864 15:54985699-54985721 AGCCAGGCACAAGTTCCTGGAGG + Intergenic
1128146965 15:65337185-65337207 AGCCAGCCCCCAGAGACTCTGGG - Intronic
1129006838 15:72380888-72380910 AGCCAGCCCCTCAATCCTTGGGG + Intergenic
1129038701 15:72666094-72666116 CGGCAGCCCCAAGTTCCTGGGGG - Exonic
1129211190 15:74071136-74071158 CGGCAGCCCCAAGTTCCTGGGGG + Exonic
1129399213 15:75269951-75269973 CGGCAGCCCCAAGTTCCTGGGGG - Exonic
1129402820 15:75294227-75294249 CGGCAGCCCCAAGTTCCTGGGGG - Exonic
1129476351 15:75786648-75786670 CGGCAGCCCCAAGTTCCTGGGGG - Intergenic
1132350963 15:101139474-101139496 AGCCAGCCCCAGGAGCCCCCCGG - Intergenic
1202955792 15_KI270727v1_random:78930-78952 ATTCAGCCCCAACATCCTCCTGG + Intergenic
1132464584 16:71813-71835 AGCCAGACCCCAGATGCTCAGGG - Intronic
1132671986 16:1105811-1105833 GGCCAGCCCCAGGATCCTCTAGG - Intergenic
1133019960 16:2963055-2963077 CGCCAGCTGGAAGATCCTCGCGG + Intergenic
1134279157 16:12802755-12802777 AGCAAGCGCCAAGACCCTCAGGG + Intronic
1134746571 16:16593465-16593487 AACCAGCCCCCAGTTCCCCGTGG + Intergenic
1134998902 16:18760215-18760237 AACCAGCCCCCAGTTCCCCGTGG - Intergenic
1140133273 16:72183009-72183031 AGAAAGCCCCAAGACCCTCTGGG - Intergenic
1141647296 16:85374665-85374687 AGCCAGGCCCATGACCCTGGAGG + Intergenic
1142996886 17:3765800-3765822 ACCCAGCCCCCAGATCCTGGTGG - Intronic
1143822585 17:9576772-9576794 AGCCAGCCCAAAGATGCTGGAGG - Intronic
1145971208 17:28957468-28957490 ATCCAGCCCCAAGTTTCCCGTGG - Exonic
1146158874 17:30548346-30548368 AGCAAGCCCCAAGGTCCTCAGGG + Intergenic
1146174223 17:30654681-30654703 CCCCAGCCCCAAATTCCTCGGGG - Intergenic
1146347678 17:32070708-32070730 CCCCAGCCCCAAATTCCTCGGGG - Intergenic
1151173574 17:72268609-72268631 AGCCAGACCCCAGATGCTCTGGG - Intergenic
1151989255 17:77563884-77563906 AGCCGGGCCCAAGATCCAGGGGG + Intergenic
1152032991 17:77855201-77855223 ACACAGCCCCAGGATCCTCCAGG + Intergenic
1152071814 17:78137853-78137875 GGCCACCCCCAACATGCTCGCGG - Intronic
1152576659 17:81144122-81144144 AGTGAGCCCCAAGTTCCTGGAGG - Intronic
1152664426 17:81559134-81559156 AGCCAGCCCCTTGTTCCTCCAGG + Exonic
1154303187 18:13212743-13212765 AGCCAGCATGAAGCTCCTCGTGG + Intergenic
1160920983 19:1520442-1520464 AGGCAGCCCCATGAGCCTCCTGG + Intergenic
1161616486 19:5273678-5273700 AGTCAGCCCCATGATCCTGGGGG + Intronic
1161988370 19:7669995-7670017 AGTCAGGACCAAGATCCTAGGGG - Intronic
1163250383 19:16123210-16123232 AACCAGCACCAAGATGATCGTGG + Intronic
1163322258 19:16581693-16581715 AGCCAGTCCCAAGAGTCTCCTGG + Intronic
1163375944 19:16930663-16930685 GGAGAGCCCCTAGATCCTCGTGG + Intronic
1163723181 19:18907830-18907852 AGACAGCCCCCAGATGCGCGTGG - Intronic
1164749355 19:30640570-30640592 AGTCAGGCCCAAGATCCTCCAGG + Intronic
1164913017 19:32027538-32027560 AGCCAGCCCCCAGCTCTTCTGGG + Intergenic
1166507231 19:43378874-43378896 AGCCAGGCCCACCATCCTCTGGG + Intergenic
1168094474 19:54106849-54106871 AGCCACCCCCAGGACCCTCAGGG + Exonic
927056951 2:19374017-19374039 AGCAAGCCCCAAGGTCCTACAGG + Intergenic
929012730 2:37461380-37461402 AGCCAGACCCAAGCTCCTATAGG - Intergenic
929507935 2:42542967-42542989 CCCCAGCCCCAAACTCCTCGGGG - Intronic
932123134 2:69119359-69119381 AGCCAGCCCACAGAGCCACGGGG - Intronic
934663069 2:96153481-96153503 AGCCAGCCCCCAGATCCATGGGG + Intergenic
935530681 2:104229440-104229462 ATCCACCACCAAGATCGTCGTGG - Intergenic
937266792 2:120621577-120621599 AGCCATAACCAAGATCCCCGTGG + Intergenic
938909827 2:135876077-135876099 AGCCTGTCCCAGGCTCCTCGCGG + Intronic
947374426 2:229481401-229481423 AGCCAGCCACAGGATGCTCCTGG - Intronic
947596071 2:231412454-231412476 GGCCAGCCCCTTGCTCCTCGCGG - Intergenic
1171164693 20:22959453-22959475 AGCCAGCCCCAAGAATTTCAGGG + Intergenic
1171487115 20:25493343-25493365 AGGCAGCACCAAGATCCCTGTGG + Intronic
1173168184 20:40700798-40700820 AGCCGGCCCCAAGGTCCTCAAGG - Intergenic
1178200786 21:30402517-30402539 ATCCAGCCCCAAGATTCTATTGG - Intronic
1179827158 21:43972547-43972569 AGCAAGCCCCAGGCTCCTCCTGG - Intronic
1184081093 22:42220775-42220797 AGCCAGCCTCAGTAACCTCGGGG - Intronic
956451388 3:69378517-69378539 AAACAGCCCCAGGATCCTGGTGG - Intronic
956660836 3:71595601-71595623 AGCCAGCGCAAAGATCCATGAGG - Intergenic
959405514 3:105958146-105958168 CCCCAGCCCCAAGTTCCTTGGGG + Intergenic
961645643 3:128391419-128391441 AGCCAGGGCCCAGAACCTCGAGG - Intronic
962263396 3:133928764-133928786 AGCCAGCCTCAAGACCCTCCAGG + Exonic
968629299 4:1641921-1641943 AGCAAGCCCCAAGATGCCCAGGG + Intronic
969623826 4:8292516-8292538 AGGCTGCCCCAAGCGCCTCGGGG + Intronic
982435613 4:155381435-155381457 AGCAAGCCCCAAGGTCCCCAGGG + Intergenic
985096755 4:186420502-186420524 AGGCAGCCCCATGACCATCGGGG - Intergenic
1000230717 5:159312709-159312731 AGCCAGACTCCAGATCCTCATGG - Intergenic
1000572855 5:162936172-162936194 AGAAAGGCCCAAGATCCTCACGG - Intergenic
1001042041 5:168343049-168343071 ATCCAGCCCTAAGAGCCTGGGGG + Intronic
1005225991 6:23642480-23642502 AGCTAGAACCAAGACCCTCGGGG + Intergenic
1005386949 6:25294393-25294415 CTCCAGCCCCAAGATCCTCTAGG - Intronic
1006433282 6:34011536-34011558 AGCGAGCCCCCAGGTCCTCCTGG + Intergenic
1008713211 6:54255043-54255065 AGCCAGCCCTGAGATGCTCTTGG + Intronic
1015754402 6:136593020-136593042 AGGCAGCCCCAAGATGCTAATGG - Intronic
1017901749 6:158724008-158724030 AGCCAGCCTCAGCATCCTCTCGG + Intronic
1023743655 7:43302617-43302639 AGCCAGCCACATCATCCTCCCGG - Intronic
1024571287 7:50724707-50724729 AGCCAGCCCCCAGCTCCTTCAGG - Intronic
1029926850 7:104328217-104328239 AGACAACCCCAGGATCCTGGTGG - Intergenic
1037612070 8:20484227-20484249 AGATAGCCCCATGATCCTGGGGG + Intergenic
1037856081 8:22371259-22371281 ACCAAGCCCCAAGATTCTCTGGG - Intronic
1037975013 8:23202806-23202828 AGCCACCGCCACGATCCTCTGGG - Intronic
1039612809 8:38932731-38932753 AAACAGCCCCAGGATCCTTGAGG - Intronic
1045681140 8:104661655-104661677 AGGCAGCATCAAGATCCTCTGGG + Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1049731220 8:144179538-144179560 AGCCAGCACCATCATCCTCCTGG + Exonic
1051535930 9:18157780-18157802 AGCCACCCCCACGATCTTCTTGG + Intergenic
1059388765 9:113985615-113985637 AGCCAAAACCAAGATGCTCGTGG - Intronic
1061062429 9:128257381-128257403 TGGCAGCCCCAAGTTCCTGGGGG + Exonic
1061302078 9:129711133-129711155 AGCCAGCCCCAAGATCCTCGTGG - Intronic
1062073049 9:134568665-134568687 AGCCAGCCCAAAGACTCTGGAGG + Intergenic
1187176234 X:16898482-16898504 ATCCAGCCACAAGACCCTCGAGG - Intergenic
1187586369 X:20666548-20666570 AGCCAGGCACAAGCTCCTCCTGG - Intergenic
1187612298 X:20955639-20955661 AGCAAGCCCCAAGGTCCTGCAGG + Intergenic
1188461854 X:30436327-30436349 TGCCAGTTCCAAGATCCTGGAGG + Intergenic
1188722687 X:33543158-33543180 GGCCAGCCCCTTGATCCTCATGG + Intergenic
1197727761 X:129787807-129787829 AGGTAGCCCCAAGAACATCGAGG + Intronic