ID: 1061303568

View in Genome Browser
Species Human (GRCh38)
Location 9:129720152-129720174
Sequence GCGGGGAGAGGCGCTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 2, 1: 0, 2: 3, 3: 23, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061303568 Original CRISPR GCGGGGAGAGGCGCTTGCTG AGG (reversed) Intronic
900568938 1:3348905-3348927 GTGGGGAGAGGCACCTGATGGGG + Intronic
901025322 1:6276069-6276091 GCGGGGTGAGGGGCTCGCTGAGG - Intronic
901026184 1:6279832-6279854 GCTGGGAGAGGGGCTTGGAGGGG + Intronic
901404006 1:9033928-9033950 GAGGGGAGTGGGGCTGGCTGGGG - Intergenic
901506596 1:9689487-9689509 GCGGGGCGGGGCGCCGGCTGGGG - Intronic
901765373 1:11496669-11496691 GCGGAGGGAGGTGCTGGCTGAGG + Intronic
902736905 1:18407328-18407350 GCGGGCAGAGGAGGTTTCTGAGG - Intergenic
902875515 1:19338516-19338538 GCGGCGGGAGGTGCGTGCTGCGG + Intergenic
902877584 1:19350065-19350087 AGGAGGAGAGGCGCCTGCTGGGG - Intronic
904356953 1:29946472-29946494 GCAGGGAGAGGAGCTGGCGGTGG + Intergenic
904627667 1:31816033-31816055 GGGGAGGGAGGCCCTTGCTGAGG + Exonic
905922139 1:41726901-41726923 GGGGGCAGGGGCTCTTGCTGTGG + Intronic
907223858 1:52927220-52927242 GCGGGGTGGGGCGCGTCCTGTGG - Exonic
910861128 1:91743257-91743279 GTGAGGAGAGGAACTTGCTGTGG + Intronic
911002341 1:93179879-93179901 GCGAGGCGAGGCTCTCGCTGGGG - Intronic
911146710 1:94559383-94559405 GCGGGGAGGGGGGCTGGGTGGGG + Intergenic
914053822 1:144153191-144153213 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
914125324 1:144813174-144813196 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
917878204 1:179306263-179306285 GTGGGTAGTGGCCCTTGCTGGGG + Intronic
920522136 1:206635661-206635683 GCGGGGAGAGGCGCCAGTTGGGG - Exonic
920805615 1:209231568-209231590 GCGCGGAGAGGCGCAGGCAGGGG - Intergenic
922024686 1:221739538-221739560 GCGGGCAGAGCCGCTGGATGAGG + Exonic
1063457216 10:6192452-6192474 GCAGGGAGAGGTGCCAGCTGTGG + Intronic
1064860056 10:19816656-19816678 GCAGGCAGCGGCGCTGGCTGTGG + Exonic
1064901663 10:20302013-20302035 GAGGGGAGAGGGGCTAGCTAAGG - Intergenic
1065636753 10:27742622-27742644 GCGGGGTGAGGGGTATGCTGGGG - Intronic
1067830060 10:49606399-49606421 CAGGGGAGGGGGGCTTGCTGGGG - Intergenic
1072003630 10:91221018-91221040 GCGGGGAGAGCGGCCGGCTGCGG + Intronic
1072943603 10:99789425-99789447 GCGGGGAGGGGCGGGTGCAGTGG + Intronic
1073135390 10:101217475-101217497 GCGGGCAGCGGCGGTAGCTGTGG - Intergenic
1075028113 10:119001932-119001954 GCAGGGAGATGCTCTTCCTGTGG + Intergenic
1076710616 10:132331922-132331944 GCGGGGGGTTGCGCTTGCGGTGG - Intergenic
1080107456 11:28525842-28525864 GCAGGGGGCGGCGCTTGTTGGGG + Intergenic
1083274155 11:61587550-61587572 GCGGCGAGTGGTGCTGGCTGGGG - Intergenic
1083304683 11:61756200-61756222 GAGGGGAATGGCGCTGGCTGAGG + Intronic
1083477319 11:62922832-62922854 GCGGGGGGCGGCGCTTGGTGGGG - Intergenic
1083756795 11:64796286-64796308 GCTGGGTGAGGCGGTTGGTGGGG + Exonic
1083997860 11:66280905-66280927 GCTGGCAGAGGAGCCTGCTGGGG - Intronic
1084021366 11:66420112-66420134 GCGGGGGGAAGCGCTCGCTTGGG + Intergenic
1084464313 11:69313333-69313355 GCGGGGAGAGGAGCTGGCTCTGG + Intronic
1084892449 11:72243355-72243377 GCCTGGAGAGGTCCTTGCTGGGG + Intronic
1089622049 11:119727929-119727951 GCGCGGAGAGTCGGCTGCTGCGG - Intronic
1090260441 11:125315153-125315175 GTGGGGAGAGGGGGATGCTGTGG - Intronic
1090416979 11:126547506-126547528 GCTGGGAGAGGAGCGTGCAGGGG + Intronic
1090937330 11:131354638-131354660 GTGGGGAGGGGCGGTTGGTGGGG + Intergenic
1099149802 12:79096227-79096249 GCAGGGAGAGGCTTTTTCTGAGG - Intronic
1102025525 12:109712371-109712393 GCCGGGAGAGGCGCCCGCGGCGG - Intergenic
1102256453 12:111418302-111418324 GCGCGCAGCGGCGCGTGCTGCGG - Exonic
1102828808 12:115975648-115975670 GCTGGGAGAGACGTTTGGTGAGG - Exonic
1103738806 12:123077947-123077969 GCTGGGAGAGCTGCGTGCTGGGG - Intronic
1103778684 12:123384676-123384698 GGGAGGAAAGGCGCCTGCTGCGG - Intronic
1104964824 12:132504141-132504163 GAGGGGAGAGGCCCTTGCTGTGG + Intronic
1105806245 13:23953246-23953268 GCGGGGAGGGGAGGTGGCTGGGG - Intergenic
1105857481 13:24386015-24386037 GCTGGGAGAGGGGCTTGGAGGGG - Intergenic
1106019892 13:25904490-25904512 GCAGGAAGAGGCGCATGGTGAGG - Intronic
1112504879 13:99969680-99969702 GGGAAGAGAGGCGCTTGCCGGGG + Intronic
1113031269 13:105996509-105996531 GCTGGGCGAGGAGCTTGCTTCGG - Intergenic
1113639210 13:111945053-111945075 CCTGGGAGAGGCGCCCGCTGAGG - Intergenic
1113693967 13:112330975-112330997 GCCTGGAGAGGCGAGTGCTGCGG + Intergenic
1113799502 13:113079023-113079045 GCGGGTGGAGGCTCTTGCTGGGG - Intronic
1113874260 13:113584802-113584824 GCGCGGAGAGGCGCGGGCTGGGG - Exonic
1114620724 14:24094551-24094573 GCGGGCAGGGGCGACTGCTGTGG + Intronic
1116563546 14:46415477-46415499 ATTGGGAGAGGAGCTTGCTGTGG + Intergenic
1117302560 14:54443367-54443389 GCAGGGGGTGGCGCTCGCTGGGG - Intergenic
1119485638 14:74984891-74984913 GTGGGGGAAGGCGCTTGCAGGGG + Intergenic
1120844211 14:89111963-89111985 GCAGGGAGTGGCACTCGCTGGGG - Intergenic
1121342998 14:93116029-93116051 GCGGGGCGCGGGGCTTCCTGGGG + Intronic
1126150886 15:45522777-45522799 GCGGGGAGAGGCGGTGGCTGTGG - Exonic
1126837173 15:52679159-52679181 GCGGAGCGAGGCGGTGGCTGAGG - Intronic
1128374760 15:67066630-67066652 GAGGGGAGAGCGGGTTGCTGCGG + Intronic
1128744027 15:70101234-70101256 GCGGGGAGTGACGCTGGGTGAGG - Intergenic
1129114563 15:73358061-73358083 GAGAAGAGAGGAGCTTGCTGAGG + Intronic
1129156625 15:73722203-73722225 GAGGAGAGAGGAGGTTGCTGAGG - Intergenic
1129235787 15:74223011-74223033 GCAGGGAGAGGCACATGATGTGG + Intergenic
1129612407 15:77071099-77071121 GAGGAGCGAGGCACTTGCTGGGG - Exonic
1131200123 15:90388645-90388667 GCGGCGAGAGGCGCTGGGTGGGG - Intronic
1133130127 16:3671685-3671707 GCGGGGAGAGGACCCTGCTGGGG - Intronic
1133362612 16:5186409-5186431 GCAGGGAGTGGCGCTCGTTGGGG + Intergenic
1135487024 16:22874647-22874669 GCTGGCAGAGGCACCTGCTGGGG + Intronic
1136104127 16:28016904-28016926 GCAGGGAGATGAGCATGCTGTGG - Intronic
1138101132 16:54253184-54253206 GTGTGGAGAGGCACTGGCTGGGG - Intronic
1139451385 16:67029986-67030008 GCGGGGAGACGCTTTTCCTGGGG + Intronic
1139976641 16:70817567-70817589 GCAGGGAGAGGAACTTTCTGTGG - Intronic
1140515118 16:75535718-75535740 TCGGGGAGGGGCGCTGGCCGAGG + Intronic
1141132394 16:81445061-81445083 GCGGGGGGCGGCGCGTGCGGCGG - Intergenic
1141634050 16:85304340-85304362 GTGGGGAGAGGCCCTCGGTGGGG + Intergenic
1142024506 16:87805200-87805222 GCGGGGAGAGCCCCTGCCTGGGG - Intergenic
1144668999 17:17120945-17120967 GAGGGGAGAGGTGCTGGCTGAGG + Intronic
1144757078 17:17686299-17686321 GTGGGGTGAGGGGCTTGGTGGGG + Intronic
1144764132 17:17723753-17723775 GCGGGGAGGGGCGCGCGATGAGG - Intronic
1147322309 17:39653612-39653634 GCGAGGAGAGGCTCTGGCTGTGG - Exonic
1148564541 17:48625398-48625420 GCCGGGAGAGGAGCTGGCGGGGG - Intronic
1150150935 17:62808334-62808356 GCGGGGAGGCGCGGTTGCTAGGG - Exonic
1151656355 17:75498030-75498052 GCTGGGAAAGACCCTTGCTGGGG + Intronic
1151830031 17:76544226-76544248 GCTGGGAGGGGGGCTGGCTGGGG - Intronic
1151966415 17:77433913-77433935 GCAGAGAGGGGAGCTTGCTGTGG + Intronic
1151983728 17:77528921-77528943 GCGGGCAGAGGGGCTCGCAGGGG + Intergenic
1152136121 17:78504717-78504739 GCCGGGGGACGCGCTTGCTGGGG + Intronic
1152350160 17:79779592-79779614 GGTGGGAGAGGGGCTGGCTGGGG - Intronic
1152715731 17:81899659-81899681 GTGAGGGGAGGCGCCTGCTGCGG + Intronic
1152797747 17:82316351-82316373 GAGGGCAGAGGCCCTTGGTGGGG + Exonic
1152879795 17:82808441-82808463 GTGGGGGGAGGCCCCTGCTGTGG + Intronic
1153070428 18:1098547-1098569 GCGGGGAGCGGCGCTCGTCGGGG - Intergenic
1153197333 18:2614946-2614968 GCGGACAGAGGCGGATGCTGGGG + Intronic
1153466556 18:5394781-5394803 CCGGGGATAGGCGCTGGCTCAGG - Exonic
1153945936 18:10017476-10017498 GTGGGGAGAGGCTGGTGCTGGGG + Intergenic
1153959891 18:10131868-10131890 GCGGGGTGAAGCGCTGTCTGGGG + Intergenic
1155152921 18:23136309-23136331 GCGGCGAGAGGCGCCGGCCGGGG - Exonic
1155591963 18:27437182-27437204 ATGGGGAGAGGGGATTGCTGTGG - Intergenic
1156452508 18:37274733-37274755 GCGGGGCGTGGCGGGTGCTGGGG + Intronic
1158558325 18:58493121-58493143 GCGGGGACAGGAGCTATCTGGGG + Intronic
1159903464 18:74069339-74069361 GTGTGGAGAGGGGCTTGCTGTGG - Intergenic
1160030136 18:75250333-75250355 GCGGGGAGAAGCTCCTGCCGGGG - Intronic
1160752093 19:739141-739163 GTGGGGCGAGGTGCTGGCTGTGG + Intronic
1161683482 19:5692040-5692062 GCAGGCAGAGGCGCTGGCCGTGG - Exonic
1163591182 19:18194933-18194955 GCGGGGAGAGGCGGGGGATGAGG - Intronic
1165109649 19:33494232-33494254 GTGGGGAGAGGCGAGGGCTGTGG - Intronic
1165363968 19:35352580-35352602 GCAGAGAGCGGCGCCTGCTGAGG + Exonic
1167311350 19:48739509-48739531 GCTGGGAGATGCGCTTGGCGCGG + Exonic
1168054969 19:53858298-53858320 GCAGGGAGAGCCTCTGGCTGTGG + Intergenic
1202693298 1_KI270712v1_random:105849-105871 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
925640758 2:5984096-5984118 GAGGGGAGGGGCTCTTCCTGGGG - Intergenic
927667353 2:25041988-25042010 GCGGGGCGAGGGGCTCGCAGAGG + Intergenic
928640134 2:33289547-33289569 GTGGAGACAGGGGCTTGCTGTGG + Intronic
929673434 2:43898965-43898987 GCGGGGAGCGGCGGGTGGTGCGG - Intronic
931708733 2:64969320-64969342 GCGGGGGGCGGCGCTCACTGGGG - Intergenic
932144751 2:69307276-69307298 GCGGGCAGAGGGGCTTGGAGGGG + Intergenic
933189587 2:79319506-79319528 AAGGGGAGAGGAGGTTGCTGTGG - Intronic
933953270 2:87348710-87348732 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
934237501 2:90245055-90245077 GCGCGGAGAGGCGCTGGCGCCGG - Intergenic
934275689 2:91571610-91571632 GCGCGGAGAGGCGCTGGCGCCGG + Intergenic
934477411 2:94602683-94602705 GCTGGGAAAGGAGCTGGCTGAGG - Intronic
934604319 2:95682675-95682697 GCGGGGAGGGGCGCAGGCCGGGG - Intergenic
936029123 2:109057697-109057719 GTGGGGAGAGGTGCAGGCTGAGG + Intergenic
936427795 2:112435019-112435041 GCAGGGGGAGCCACTTGCTGGGG - Intergenic
937081455 2:119143136-119143158 GAGTGGAGAGGCGCTGGCTTGGG + Intergenic
937208636 2:120253009-120253031 GCGGGGTGGGGCGCGGGCTGGGG + Intronic
937273797 2:120671633-120671655 CCGGGGAGAGTTGCTAGCTGTGG - Intergenic
937364295 2:121249520-121249542 TCGGGGAGAGGGGCTTGATTAGG - Intronic
939972501 2:148678445-148678467 GCAGGGGGTGGCGCTTGTTGAGG + Intronic
942241200 2:173964956-173964978 GCGGGGAGACGGCGTTGCTGGGG + Intronic
944055216 2:195515943-195515965 GCAGGGAGTGGCGCTGGTTGGGG - Intergenic
946360424 2:219216286-219216308 GCTGGGAGAGGCGGATGCTGAGG + Intronic
947250387 2:228096433-228096455 GCAGGGAGAGGGGCTTGTCGGGG - Intronic
948088123 2:235267517-235267539 GAGGGGAGAGGCCTTGGCTGTGG - Intergenic
948281098 2:236748556-236748578 TGGAGGAGAGGCGGTTGCTGCGG - Intergenic
948601912 2:239112132-239112154 GTGGAGAGAAGCTCTTGCTGGGG + Intronic
948806001 2:240453625-240453647 GCGGGGAGAGGGGGCTGCGGCGG - Intronic
1169228323 20:3870080-3870102 GCGGGGAGCTGCACTTGGTGGGG + Exonic
1175219845 20:57410426-57410448 GTGGGGAGAGGGGCCGGCTGAGG + Intergenic
1175385706 20:58593733-58593755 GCGGGGGGCGGTGCTTCCTGTGG + Intergenic
1175988296 20:62775237-62775259 GGGGGGAGATGCACCTGCTGGGG + Intergenic
1176119985 20:63450063-63450085 GCGGGGTGAGGGGCCTGCAGGGG - Intronic
1176242674 20:64082397-64082419 ACGGGGAGAAGGGCTGGCTGAGG + Intronic
1176374449 21:6080192-6080214 GCAGGGGGAGCCACTTGCTGGGG + Intergenic
1179504013 21:41828116-41828138 GCGGGGAGAGGCAGCTCCTGCGG - Intronic
1179749026 21:43458053-43458075 GCAGGGGGAGCCACTTGCTGGGG - Intergenic
1179882555 21:44299697-44299719 GCAGGGAGGGGCGGTGGCTGCGG + Intergenic
1180083416 21:45497018-45497040 ACGGGGAGAGGCGGCTGCTGAGG - Intronic
1181437047 22:22917160-22917182 GTCAGGGGAGGCGCTTGCTGTGG + Intergenic
1181670728 22:24424459-24424481 GGGCGCAGAGGCGCTTCCTGAGG + Intronic
1183272624 22:36871646-36871668 GTGGGGACACGCTCTTGCTGTGG - Exonic
1183346472 22:37311089-37311111 GCGGGGAGAGGCGGGGGCAGGGG - Intronic
950161752 3:10765629-10765651 GCGGGGGGAGGGGCTGGCAGGGG - Intergenic
950653849 3:14424535-14424557 GAGGGGAGAGGAGCTGCCTGGGG + Intronic
950963175 3:17127343-17127365 GCGGGGACAGGCTCTTCTTGTGG + Intergenic
951332909 3:21387296-21387318 GCAGGGGGTGGCGCTTGTTGAGG + Intergenic
952788190 3:37176394-37176416 CCCGGGAGTGGCGCTTGCCGCGG + Intronic
953307564 3:41844213-41844235 GCAGGGGGCGGCGCTCGCTGGGG + Intronic
953518688 3:43621672-43621694 GCGGGGAGCGGCGGTCGCAGGGG - Intronic
953694432 3:45146485-45146507 GGAGGGAGAGGCGGTCGCTGAGG - Intergenic
954226159 3:49182709-49182731 GCAGGGGGCGGCGCTTGTTGGGG + Intronic
954800922 3:53186491-53186513 GCAGGGACAGGCCCTGGCTGAGG - Intronic
955954212 3:64271722-64271744 GCGGGGAGAGGTGGTAGCTCAGG + Intronic
956632643 3:71331413-71331435 GCAGGGAGCGGCGCTTGTCGGGG - Intronic
958779389 3:98522891-98522913 GCGGGGAGAGTAGGGTGCTGTGG - Intronic
963081929 3:141402491-141402513 GCGGGGCGAGGCGCGGCCTGCGG + Intronic
963673468 3:148280610-148280632 GCAGGGAGTGGCGCTGGTTGGGG + Intergenic
963674774 3:148296369-148296391 GCGGTGGGAGGTGCTTGCTCTGG - Intergenic
968488623 4:877512-877534 CCGGGGACAGGCGCTTGCTGAGG - Intronic
968929778 4:3572695-3572717 GCTGGCAGAGGCACTTGCAGAGG + Intergenic
969561595 4:7951538-7951560 GCTGGGAGAGGGGCTGGCTGCGG + Intergenic
971280490 4:25239286-25239308 GCAGGGGGTGGCGCTTGTTGGGG + Intronic
972392601 4:38627219-38627241 GCAGGAGGCGGCGCTTGCTGGGG - Intergenic
972793859 4:42397787-42397809 GCCGGCAGAGGCAGTTGCTGGGG - Intergenic
978760488 4:112352024-112352046 GCAGGGAGAGGCACTTGCACAGG - Intronic
978997999 4:115179475-115179497 GCAGGGGGTGGCGCTTGTTGGGG + Intergenic
980392085 4:132159728-132159750 TCCTTGAGAGGCGCTTGCTGTGG + Intergenic
981782785 4:148445232-148445254 GCGGGGGGAGGCGAGGGCTGGGG + Intergenic
981833098 4:149024254-149024276 GCAAGGTGAGGTGCTTGCTGAGG + Intergenic
983547510 4:168979146-168979168 GCAGGGAGGGGGGCTTGTTGGGG - Intronic
985686074 5:1282350-1282372 GTGGAGACAGGCGCATGCTGAGG + Intronic
985897327 5:2756461-2756483 GCGGGGAGAGGTGCGACCTGGGG - Intergenic
986315957 5:6586472-6586494 GCAGGCAGAGGGGCTTGCTGGGG - Intergenic
992530100 5:77645235-77645257 GCGGGGAGGGGCGCGGGCGGGGG - Intergenic
997472308 5:134123813-134123835 GCGGGGAGAGCCAGCTGCTGGGG + Intronic
998170726 5:139870759-139870781 GAGGGGAGGGGAGCTTGGTGAGG - Intronic
999243696 5:150141968-150141990 GCAGGGAGAGGGGGGTGCTGGGG + Intronic
1003506641 6:6745760-6745782 GCAGGGAGCGGCGCTTGTCGGGG + Intergenic
1003997988 6:11563294-11563316 GCGGGGAGGGGGGCCTGGTGTGG - Intronic
1006472801 6:34237722-34237744 GCGGGGAGAGACACGGGCTGCGG + Intronic
1007098555 6:39229241-39229263 CCGGGGAGCGGTGCTTGCGGGGG - Exonic
1007702059 6:43771344-43771366 GCCGGGAGAGGCGCTCGCAGCGG - Intronic
1008379196 6:50823430-50823452 GCTGGGAGAGCCGCGAGCTGTGG - Exonic
1009407062 6:63326494-63326516 GCAGGGGGTGGCGCTTGTTGAGG + Intergenic
1012282636 6:97347082-97347104 GCAGGGAGAGGGTCTTGATGAGG - Intergenic
1014169374 6:118261934-118261956 GCAGGGAGAGGCACAGGCTGTGG - Intronic
1017552146 6:155520460-155520482 GCAGGGAGAACCTCTTGCTGAGG - Intergenic
1018795504 6:167182136-167182158 GTGGGAAGAGGCACCTGCTGCGG + Exonic
1018820817 6:167372927-167372949 GTGGGAAGAGGCACCTGCTGCGG - Exonic
1019147712 6:169985617-169985639 TCGGGGAGAGGCGCGGGCTGTGG - Intergenic
1019262918 7:92132-92154 GTGTGGAGAGGGGCTTTCTGTGG - Intergenic
1020089797 7:5332756-5332778 GCAGGAAGATGCGCTCGCTGCGG + Exonic
1025763301 7:64415480-64415502 GCGGAGGGAGGGGCTTGCAGAGG + Intergenic
1029169715 7:98621961-98621983 CAGGGGTCAGGCGCTTGCTGGGG - Intronic
1029549998 7:101232577-101232599 GCAGGGTGAGGCGCAGGCTGGGG - Intronic
1029809590 7:103034287-103034309 GCGGGGGGCGGCGCTTGTAGGGG + Intronic
1030348027 7:108455556-108455578 GAGGGGTGGGGCGCTTGCGGGGG - Intronic
1034313582 7:150110745-150110767 GCAGGGGGCGGGGCTTGCTGGGG + Intergenic
1034793314 7:153990051-153990073 GCAGGGGGCGGGGCTTGCTGGGG - Intronic
1035061627 7:156073634-156073656 GCGGGGTGGGCCACTTGCTGAGG + Intergenic
1035404336 7:158588013-158588035 GCGGGGAGGGGCGCGAGCCGGGG - Intergenic
1036213943 8:6863673-6863695 GCGGGGAGGGGCTCCTCCTGTGG + Intergenic
1036785303 8:11681475-11681497 GCGGGGTGCGGCGCTCGCGGGGG + Intronic
1036910493 8:12754452-12754474 GCGGGGAGGGGCGCTCGGCGCGG - Intronic
1037876762 8:22552317-22552339 GCGGGGAGAGGCCCCTGGAGCGG - Intronic
1039453843 8:37695658-37695680 GCGGGGAGAGCGGCGGGCTGAGG - Intergenic
1044692445 8:94894619-94894641 GCGGGGAGAGGGGGTTGTGGAGG + Intronic
1045055481 8:98364549-98364571 AGGGAGAGAGGCGCATGCTGGGG - Intergenic
1047410584 8:124621385-124621407 GGAGGGAGAGGCACTTGGTGGGG + Intronic
1049261765 8:141642745-141642767 GCGGGGTTGGGTGCTTGCTGCGG + Intergenic
1049361513 8:142214366-142214388 GCGGGGAGAGGAGGTGGCAGGGG - Intronic
1049535951 8:143182217-143182239 GAGGGGAGACACGCATGCTGAGG - Intergenic
1049552531 8:143267212-143267234 GCGGGGAGCGGCGCTGCGTGGGG - Intronic
1049557339 8:143289558-143289580 GCGGGGAGAGGCCCGGGCGGAGG + Intergenic
1053623166 9:39841589-39841611 CCGGGGAGAGCCACTTGCTCAGG - Intergenic
1053881705 9:42601639-42601661 CCGGGGAGAGCCACTTGCTCAGG + Intergenic
1053890963 9:42692653-42692675 CCGGGGAGAGCCGCTTGCTCAGG - Intergenic
1054220736 9:62409106-62409128 CCGGGGAGAGCCGCTTGCTCAGG + Intergenic
1054229978 9:62500066-62500088 CCGGGGAGAGCCGCTTGCTCAGG - Intergenic
1054460500 9:65459777-65459799 GCTGGCAGAGGCACTTGCAGAGG - Intergenic
1056777747 9:89526128-89526150 GCTGGGTGAGGCGCTGCCTGGGG - Intergenic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1061147520 9:128808622-128808644 GCGGGGAGAGGAGGTGGCTCAGG - Exonic
1061303568 9:129720152-129720174 GCGGGGAGAGGCGCTTGCTGAGG - Intronic
1061303573 9:129720179-129720201 GCGGGGAGAGGCGCTTGCTGAGG - Intronic
1061816782 9:133202069-133202091 GCTGGGCGAGGCTCTGGCTGTGG - Intergenic
1061863055 9:133477910-133477932 GTGGGGAGAGGCACTGGCTGGGG - Intronic
1062160124 9:135075388-135075410 GCGGAGAGAGGCGCGCCCTGCGG - Intergenic
1062529770 9:136994668-136994690 GCGGGGTGGGGCGCTAGCGGGGG + Exonic
1062697437 9:137882670-137882692 GCGGGCAGAGACGGTTGGTGAGG - Intronic
1203653457 Un_KI270752v1:943-965 GCTGGTAAAGGCACTTGCTGTGG + Intergenic
1186287923 X:8065557-8065579 GGGGGCAGAGGAGTTTGCTGAGG + Intergenic
1187071803 X:15895957-15895979 TCGGGGAAAGGCCCTAGCTGAGG - Intergenic
1187194816 X:17072777-17072799 GCTGGGAGAGAGGCTTCCTGAGG + Intronic
1200062124 X:153488365-153488387 GCGGGGCGAGGTCCTTGCAGCGG - Intronic
1200142910 X:153910655-153910677 GCGGGGTAGGGCACTTGCTGGGG - Intronic
1200164209 X:154025084-154025106 GCGGGGAGAGGGGCTATCAGTGG + Intronic