ID: 1061304998

View in Genome Browser
Species Human (GRCh38)
Location 9:129727017-129727039
Sequence CTTAGAGACGGGTTTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061304998_1061305010 21 Left 1061304998 9:129727017-129727039 CCCCCAGCAAACCCGTCTCTAAG No data
Right 1061305010 9:129727061-129727083 AAATCTCAAAATCGGGGGGCGGG No data
1061304998_1061305008 17 Left 1061304998 9:129727017-129727039 CCCCCAGCAAACCCGTCTCTAAG No data
Right 1061305008 9:129727057-129727079 ATCAAAATCTCAAAATCGGGGGG No data
1061304998_1061305007 16 Left 1061304998 9:129727017-129727039 CCCCCAGCAAACCCGTCTCTAAG No data
Right 1061305007 9:129727056-129727078 AATCAAAATCTCAAAATCGGGGG No data
1061304998_1061305005 14 Left 1061304998 9:129727017-129727039 CCCCCAGCAAACCCGTCTCTAAG No data
Right 1061305005 9:129727054-129727076 ATAATCAAAATCTCAAAATCGGG No data
1061304998_1061305012 23 Left 1061304998 9:129727017-129727039 CCCCCAGCAAACCCGTCTCTAAG No data
Right 1061305012 9:129727063-129727085 ATCTCAAAATCGGGGGGCGGGGG No data
1061304998_1061305009 20 Left 1061304998 9:129727017-129727039 CCCCCAGCAAACCCGTCTCTAAG No data
Right 1061305009 9:129727060-129727082 AAAATCTCAAAATCGGGGGGCGG No data
1061304998_1061305006 15 Left 1061304998 9:129727017-129727039 CCCCCAGCAAACCCGTCTCTAAG No data
Right 1061305006 9:129727055-129727077 TAATCAAAATCTCAAAATCGGGG No data
1061304998_1061305011 22 Left 1061304998 9:129727017-129727039 CCCCCAGCAAACCCGTCTCTAAG No data
Right 1061305011 9:129727062-129727084 AATCTCAAAATCGGGGGGCGGGG No data
1061304998_1061305004 13 Left 1061304998 9:129727017-129727039 CCCCCAGCAAACCCGTCTCTAAG No data
Right 1061305004 9:129727053-129727075 AATAATCAAAATCTCAAAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061304998 Original CRISPR CTTAGAGACGGGTTTGCTGG GGG (reversed) Intergenic