ID: 1061306647

View in Genome Browser
Species Human (GRCh38)
Location 9:129736376-129736398
Sequence CCTGCTGGGGAGCGGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061306647_1061306665 23 Left 1061306647 9:129736376-129736398 CCAGGCAGCCGCTCCCCAGCAGG No data
Right 1061306665 9:129736422-129736444 CATCAGGGCGCTGAGCCTTGGGG No data
1061306647_1061306664 22 Left 1061306647 9:129736376-129736398 CCAGGCAGCCGCTCCCCAGCAGG No data
Right 1061306664 9:129736421-129736443 CCATCAGGGCGCTGAGCCTTGGG No data
1061306647_1061306656 7 Left 1061306647 9:129736376-129736398 CCAGGCAGCCGCTCCCCAGCAGG No data
Right 1061306656 9:129736406-129736428 AGGCCCCATCTGCCTCCATCAGG No data
1061306647_1061306657 8 Left 1061306647 9:129736376-129736398 CCAGGCAGCCGCTCCCCAGCAGG No data
Right 1061306657 9:129736407-129736429 GGCCCCATCTGCCTCCATCAGGG No data
1061306647_1061306662 21 Left 1061306647 9:129736376-129736398 CCAGGCAGCCGCTCCCCAGCAGG No data
Right 1061306662 9:129736420-129736442 TCCATCAGGGCGCTGAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061306647 Original CRISPR CCTGCTGGGGAGCGGCTGCC TGG (reversed) Intergenic
No off target data available for this crispr