ID: 1061307955

View in Genome Browser
Species Human (GRCh38)
Location 9:129743236-129743258
Sequence GCCTCGGAGGGGCCCCTCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 209}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061307955_1061307960 -10 Left 1061307955 9:129743236-129743258 CCGCAGAGGGGCCCCTCCGAGGC 0: 1
1: 0
2: 1
3: 40
4: 209
Right 1061307960 9:129743249-129743271 CCTCCGAGGCCGCAGTGGCCAGG No data
1061307955_1061307968 16 Left 1061307955 9:129743236-129743258 CCGCAGAGGGGCCCCTCCGAGGC 0: 1
1: 0
2: 1
3: 40
4: 209
Right 1061307968 9:129743275-129743297 AGGGAGCAATGGAGACACCAAGG No data
1061307955_1061307966 5 Left 1061307955 9:129743236-129743258 CCGCAGAGGGGCCCCTCCGAGGC 0: 1
1: 0
2: 1
3: 40
4: 209
Right 1061307966 9:129743264-129743286 TGGCCAGGGACAGGGAGCAATGG No data
1061307955_1061307969 24 Left 1061307955 9:129743236-129743258 CCGCAGAGGGGCCCCTCCGAGGC 0: 1
1: 0
2: 1
3: 40
4: 209
Right 1061307969 9:129743283-129743305 ATGGAGACACCAAGGAATGATGG No data
1061307955_1061307963 -4 Left 1061307955 9:129743236-129743258 CCGCAGAGGGGCCCCTCCGAGGC 0: 1
1: 0
2: 1
3: 40
4: 209
Right 1061307963 9:129743255-129743277 AGGCCGCAGTGGCCAGGGACAGG No data
1061307955_1061307961 -9 Left 1061307955 9:129743236-129743258 CCGCAGAGGGGCCCCTCCGAGGC 0: 1
1: 0
2: 1
3: 40
4: 209
Right 1061307961 9:129743250-129743272 CTCCGAGGCCGCAGTGGCCAGGG No data
1061307955_1061307964 -3 Left 1061307955 9:129743236-129743258 CCGCAGAGGGGCCCCTCCGAGGC 0: 1
1: 0
2: 1
3: 40
4: 209
Right 1061307964 9:129743256-129743278 GGCCGCAGTGGCCAGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061307955 Original CRISPR GCCTCGGAGGGGCCCCTCTG CGG (reversed) Intronic
900119184 1:1041280-1041302 GCCCCCGAGGGGACCGTCTGCGG + Exonic
900166865 1:1247356-1247378 GCCTCGCTGGGGCCCCACTCGGG + Intergenic
900276479 1:1832685-1832707 GTCTAGGAGGGGCACCTCAGCGG + Intronic
900575460 1:3380255-3380277 CCCTCAGAGGTGCCCCTCTGTGG + Intronic
900575461 1:3380256-3380278 TCCACAGAGGGGCACCTCTGAGG - Intronic
902833855 1:19034512-19034534 GCCCCGGAGGGGCCTGTGTGAGG + Intergenic
903382656 1:22907788-22907810 GCCTCTGACGGGCCTCTCTGGGG + Intronic
904305263 1:29584954-29584976 CGCTGGGTGGGGCCCCTCTGAGG - Intergenic
904397748 1:30233859-30233881 TGCTGGGTGGGGCCCCTCTGAGG + Intergenic
904607420 1:31705355-31705377 GCCACAGAGGCGCCCCACTGTGG + Intergenic
905629932 1:39512760-39512782 TTCACGGAGGGGGCCCTCTGAGG - Intronic
905667827 1:39773430-39773452 TTCACGGAGGGGGCCCTCTGAGG + Intronic
907051828 1:51334882-51334904 GCCTGGGTGGGGCCCTCCTGAGG - Intronic
911121688 1:94302810-94302832 GCATCGGAGGGGGCCATCGGGGG + Intergenic
912857065 1:113178518-113178540 GCCTCCCAGGGGCCCTTTTGGGG + Intergenic
914947745 1:152081080-152081102 GCCCTGGATGGGCCCCCCTGTGG + Intergenic
915290809 1:154881981-154882003 GCCTGGGCAGGGCCCATCTGAGG + Intergenic
915616941 1:157046084-157046106 TCCTCGGCCGGTCCCCTCTGCGG + Intergenic
916297615 1:163237172-163237194 GCATCGGCGGGGTCCCTGTGAGG + Intronic
917195936 1:172465730-172465752 GCCTTGGTGAGGCCGCTCTGAGG - Intronic
920510923 1:206551528-206551550 GCCTTGGAGAGGCTCCTGTGAGG - Intronic
921465063 1:215477477-215477499 GCCTCAGTGGGGACTCTCTGTGG + Intergenic
922219113 1:223544260-223544282 ACATCCCAGGGGCCCCTCTGTGG + Intronic
922831438 1:228556471-228556493 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922831916 1:228608425-228608447 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922832477 1:228610666-228610688 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922833037 1:228612907-228612929 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922833598 1:228615148-228615170 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922834157 1:228617389-228617411 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922834715 1:228619630-228619652 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922835266 1:228621845-228621867 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922835825 1:228624065-228624087 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922836384 1:228626307-228626329 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922836942 1:228628546-228628568 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922837501 1:228630788-228630810 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922838062 1:228633029-228633051 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922838620 1:228635269-228635291 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922839178 1:228637494-228637516 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922839738 1:228639735-228639757 CCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922840299 1:228641966-228641988 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922840859 1:228644207-228644229 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
922841422 1:228646438-228646460 GCCTCGCAGGAGCCCCTGTGCGG - Intergenic
923092113 1:230748426-230748448 GCCTGGGAGTGGCTCCTGTGGGG + Intronic
1062976361 10:1686251-1686273 GCCTCGGCGGGGGTTCTCTGTGG + Intronic
1063186364 10:3655626-3655648 GGCTAGGAGGGGCCTCTCTGAGG + Intergenic
1065236445 10:23657514-23657536 TTCTGGGAGGAGCCCCTCTGAGG - Intergenic
1066026585 10:31364321-31364343 GCCCTGGATGGGCCCCCCTGTGG + Intronic
1066430655 10:35348364-35348386 ACCACGGAGGGGTCCATCTGAGG + Intronic
1066732741 10:38449662-38449684 GCCTGGGAGGGGCCGGTGTGAGG - Intergenic
1066732880 10:38450201-38450223 GCCTGGGAGGGGCCGGTGTGAGG - Intergenic
1066732946 10:38450444-38450466 GCCTGGGAGGGGCCGGTGTGAGG - Intergenic
1067257971 10:44662439-44662461 TCCTAGCATGGGCCCCTCTGAGG + Intergenic
1067655333 10:48187445-48187467 CCCTCGATGGGGTCCCTCTGAGG - Intronic
1071505082 10:86227256-86227278 CCCTCAAAGGGGCCCTTCTGGGG + Intronic
1071997691 10:91163370-91163392 GACTGGAAGGCGCCCCTCTGGGG - Intronic
1072070345 10:91909152-91909174 GCCTGCGAGGAGACCCTCTGAGG + Intronic
1074550725 10:114439818-114439840 GCCTTGGAGAGTCCTCTCTGGGG - Intronic
1076456921 10:130606627-130606649 GCCTCCGAGGGTCCCCTCTCAGG + Intergenic
1076885655 10:133261325-133261347 GCCTCGGAGGAGCCACCCGGAGG + Intergenic
1077227439 11:1444588-1444610 GCCTGGGCTGGGCCCCTCCGTGG - Intronic
1077488008 11:2847973-2847995 GCCCAGGAGGGGCCCCGATGAGG + Exonic
1078452795 11:11452903-11452925 GCCTCGAATGGGCCCTCCTGGGG - Intronic
1082787206 11:57323871-57323893 GGTTCTGATGGGCCCCTCTGCGG + Intronic
1084557665 11:69884480-69884502 GCCTGGGGGCGGCCCCACTGGGG + Intergenic
1084607572 11:70181346-70181368 GGCTCTGAGGGGCCCTTCTCCGG - Intronic
1085281503 11:75334030-75334052 GCCTGGGATGGGACCTTCTGTGG - Intronic
1087078455 11:94147662-94147684 GCCTCGCAGGTTCCCTTCTGAGG + Intronic
1089273202 11:117315676-117315698 GCCTGGGGGGCGCCCCCCTGGGG - Exonic
1089492669 11:118893663-118893685 GGCCATGAGGGGCCCCTCTGTGG - Exonic
1089783061 11:120887865-120887887 GACTGGGAGGGGCCTCCCTGAGG + Intronic
1090788757 11:130070983-130071005 GCCTTGGAGGAGCCCTGCTGTGG + Intronic
1090972246 11:131653748-131653770 GCCGCGGGGGGAGCCCTCTGAGG - Intronic
1092126964 12:6081196-6081218 GCCTCTGAAGGGCCCATTTGTGG - Intronic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1094487062 12:30933715-30933737 ACCTAGGAGGGGCTGCTCTGGGG + Intronic
1096368366 12:51047815-51047837 GCCTGGGAGCGGCCCCTGTGCGG - Intergenic
1097377999 12:58861021-58861043 GCCTAGGAGGGACCCCTAGGGGG - Intergenic
1103856371 12:123973262-123973284 GGCTCGGAGGCGCACCTGTGAGG + Exonic
1104587988 12:130062830-130062852 GCCTCGGTGGGGACTCTCTGTGG - Intergenic
1104976800 12:132555811-132555833 ACCTGGGAGGGCCCCATCTGAGG + Intronic
1106410890 13:29510906-29510928 GTCTGGGTGGGGCCCCTATGGGG + Exonic
1106603737 13:31208938-31208960 GCCGGGCAGGGACCCCTCTGAGG - Intronic
1106770197 13:32954296-32954318 CCCTCGGACTGGCCCCTCTCCGG + Intergenic
1110626947 13:77662898-77662920 GCCCTGGATGGGCCCCCCTGTGG + Intergenic
1113613626 13:111665544-111665566 GCCAGGGCTGGGCCCCTCTGCGG + Intronic
1114255885 14:21001122-21001144 GGCTCGGAGGGGACCCTTTGAGG - Exonic
1114496521 14:23136831-23136853 GCCTCGGCGGGGCCTCCGTGTGG + Intronic
1118356276 14:65016577-65016599 GCCTAGCCGGGGCCCCTCTCTGG + Intronic
1119588643 14:75863074-75863096 GCCTCAGTGGGGACCCTGTGAGG + Intronic
1121263658 14:92584580-92584602 GCCTCTGAGGGTCCCCAGTGAGG - Intronic
1122580976 14:102771374-102771396 GGCTCAGAATGGCCCCTCTGTGG - Intergenic
1122757144 14:103990451-103990473 GGCTGGGAAGGGCCTCTCTGGGG - Intronic
1122976103 14:105171404-105171426 GCCTGCGAGAGGTCCCTCTGAGG + Intergenic
1123707249 15:22959384-22959406 GCGTGGGAGCGCCCCCTCTGTGG - Intronic
1130927519 15:88396624-88396646 GCCTTTGAGGGGCCCCTTGGGGG - Intergenic
1132655514 16:1040384-1040406 ACCTCGGGGGGGATCCTCTGGGG - Intergenic
1136026845 16:27474118-27474140 GCCTCGCGGGGTCCCCTATGGGG + Intronic
1139422435 16:66856912-66856934 GCCCAGGGAGGGCCCCTCTGGGG - Intronic
1140279977 16:73545107-73545129 GCTTCCGAGGGGCCTCACTGTGG - Intergenic
1140477270 16:75245256-75245278 GACCCGGAGGGGCAGCTCTGTGG - Intronic
1144677766 17:17172841-17172863 CCCTTGGGAGGGCCCCTCTGGGG + Intronic
1147401791 17:40184624-40184646 GCCTCCGAGAGGACACTCTGAGG + Exonic
1147654448 17:42080831-42080853 GCCTCTGAGTGGCCCTGCTGTGG - Intergenic
1148897141 17:50845565-50845587 GCCTAGAAGGGGCCTCTCTGGGG + Intergenic
1149611316 17:57959515-57959537 GCCTGGGAAGGGCCTCTCTCAGG - Intergenic
1151199776 17:72459192-72459214 GTCTCTGAGGGTCCCCTCTCTGG + Intergenic
1151774422 17:76189743-76189765 GCTTCGGAGGGTCCCTTCTCCGG - Intronic
1154412037 18:14146810-14146832 GGCTGGGAGAGGCCCCTCTGTGG - Intergenic
1155403754 18:25465577-25465599 CCCTCGGAGTGGCCCCTGCGGGG - Intergenic
1157220503 18:45825659-45825681 GCCTGGGAGGGCCCTCACTGGGG + Exonic
1157589087 18:48825303-48825325 GCCTCTGAGGGGTGTCTCTGAGG + Intronic
1160807542 19:999124-999146 GCCTCGGGGGGTGCCTTCTGGGG - Intergenic
1161204132 19:3031805-3031827 GGCTAGGAGGGGCCGTTCTGAGG - Intronic
1161456813 19:4373752-4373774 GGCTCTCAGGGGGCCCTCTGTGG - Intronic
1161963661 19:7536025-7536047 GCACCCGAGGGGCCCCTCTTGGG + Intronic
1162361001 19:10220431-10220453 GCCTCGGGTGGGTCCCTCGGTGG - Intronic
1162438608 19:10679167-10679189 GCCTCGGAGGGGACCCCAGGTGG - Exonic
1163233319 19:16017878-16017900 TCATGGGAGGGGTCCCTCTGGGG + Intergenic
1163620549 19:18357317-18357339 GACTCAGAGGGGTCCCCCTGAGG - Intronic
1164643554 19:29843253-29843275 GCCTGGGAGGGGCCCCTGGGAGG - Intergenic
1165113304 19:33514355-33514377 GCCTCTGAGGGTCCCATGTGAGG - Intronic
1166299811 19:41907220-41907242 GCCTGGGAGGGGCCCAGCTGGGG + Exonic
1167156453 19:47742053-47742075 GCTGCGGAGGGGCCCATCTGAGG - Exonic
924966035 2:77270-77292 GCCTCAGTGGGGACTCTCTGTGG + Intergenic
925158422 2:1664238-1664260 CCCTGGGTGGGGCCCCTCAGAGG + Intronic
925409464 2:3631673-3631695 GGCTCGGAGGGGCCCCTGCTCGG + Intronic
925707731 2:6703168-6703190 GGCTCAGAGGAGCCCTTCTGAGG + Intergenic
926077362 2:9951879-9951901 GCCGCGGGGGGGCCGCGCTGAGG + Intronic
926127265 2:10279287-10279309 GCCTCGGAGGAGCCACTGGGCGG + Intergenic
927091409 2:19715466-19715488 GCCTGGGAGCGGCCAATCTGTGG + Intergenic
927215412 2:20665784-20665806 GCCTGGGCCGGGCCTCTCTGTGG + Intergenic
927939098 2:27092606-27092628 GCCTTGGCGTGGCCTCTCTGCGG + Intronic
934520812 2:95019057-95019079 GCCTCTGAGGTGCACCTCTCTGG + Intergenic
934657019 2:96121736-96121758 GGTTAGGAAGGGCCCCTCTGAGG - Intergenic
946189725 2:218002006-218002028 GCCCCACAGGAGCCCCTCTGAGG + Intronic
946189726 2:218002007-218002029 TCCTCAGAGGGGCTCCTGTGGGG - Intronic
947736475 2:232457906-232457928 GGCTCGGATGGCACCCTCTGAGG - Intronic
947876966 2:233474072-233474094 AACTCGGAGTCGCCCCTCTGGGG + Intergenic
948549974 2:238764828-238764850 GCTCCTGAGGGGCTCCTCTGTGG + Intergenic
948869866 2:240792413-240792435 GCCTTGGAGGGGCCCAGCTCTGG - Intronic
948896654 2:240930836-240930858 GCCAAGGAGGGGGTCCTCTGTGG + Intronic
1170366240 20:15601265-15601287 GCCTCTCAGGAGCTCCTCTGTGG + Intronic
1171217450 20:23362420-23362442 GCCGAGGAGGGGCTTCTCTGTGG + Intronic
1172167472 20:32907853-32907875 GAATGGGAGGGGCCCCTCTGGGG + Intronic
1172700758 20:36852329-36852351 GCCCCGGAAGGGCTGCTCTGTGG + Intronic
1173337334 20:42123507-42123529 GCCAAGGAGGGTCCCCTCAGAGG + Intronic
1173656653 20:44704369-44704391 GACTTGGAGGGGCTCCTCGGTGG + Intergenic
1173836400 20:46128812-46128834 GCCTCTGAGGAGCCCCTCCCTGG - Intronic
1175744440 20:61445432-61445454 GCCTCAGAGGGCCCTCACTGTGG - Intronic
1176368076 21:6045599-6045621 GCCTTGGCTGGGCCCCTCAGTGG + Intergenic
1176860996 21:14011517-14011539 GGCTGGGAGAGGCCCCTCTGTGG + Intergenic
1177792516 21:25735648-25735670 GCCGCGGGGGGGCCCTTGTGGGG - Intronic
1179755443 21:43492943-43492965 GCCTTGGCTGGGCCCCTCAGTGG - Intergenic
1180790902 22:18575061-18575083 GCCTAGGACGGACCCCTGTGGGG - Intergenic
1181230833 22:21420253-21420275 GCCTAGGACGGACCCCTGTGGGG + Intronic
1181247814 22:21514616-21514638 GCCTAGGACGGACCCCTGTGGGG - Intergenic
1182171084 22:28230269-28230291 GGCTGGGAGGGGCCTTTCTGTGG - Intronic
1184101753 22:42344556-42344578 GCATCGCAGGTCCCCCTCTGTGG + Intergenic
1185018620 22:48360093-48360115 GGGTGGGAGGGGCGCCTCTGTGG - Intergenic
1185366190 22:50437995-50438017 GGCTGGGAGAGGCCCCTCTGTGG + Intronic
1185404725 22:50641383-50641405 CCCTAGGAGGGGCCACCCTGAGG - Intergenic
950242156 3:11380348-11380370 GGCTAGGAGGGAACCCTCTGGGG - Intronic
952866915 3:37861168-37861190 GCCGCGCCCGGGCCCCTCTGCGG + Intergenic
953716335 3:45319671-45319693 GCCAGGGAGGGGACCCACTGAGG - Intergenic
954459273 3:50617247-50617269 CCCTCGCTGGGCCCCCTCTGCGG + Intronic
954654691 3:52186685-52186707 GGCTTGGAGAGGCCTCTCTGAGG - Intergenic
955367966 3:58327649-58327671 ATCTCAGAGGGGCTCCTCTGAGG + Intergenic
955827608 3:62965001-62965023 GTCTTGCTGGGGCCCCTCTGAGG + Intergenic
956650829 3:71503152-71503174 GCATCAGAAGAGCCCCTCTGTGG + Intronic
961455763 3:127023129-127023151 GCCTCTGAGGGGCCAGCCTGGGG + Intronic
967220443 3:187243749-187243771 GCCTCTGAAGGGCACCCCTGGGG + Intronic
968432602 4:567580-567602 GCCTGGGAGAGGCTCCTTTGGGG - Intergenic
968959273 4:3734736-3734758 GCGTCTGATGGGCTCCTCTGGGG + Intergenic
969305741 4:6325410-6325432 GCCTGGGCAGGGCCCTTCTGTGG - Intronic
972355920 4:38279561-38279583 GCCTCGCAGGGGTCTCTGTGGGG - Intergenic
982017900 4:151174197-151174219 TCATCTGAGGAGCCCCTCTGGGG + Intronic
990740614 5:58908832-58908854 GCCATGGAGGGACCCCTCAGTGG + Intergenic
991009257 5:61865771-61865793 GCCTCAGAGTGGCCTCTCTGTGG - Intergenic
992024581 5:72657873-72657895 GTCTCTGAGGGGGCACTCTGAGG + Intergenic
993898826 5:93570923-93570945 CCCTCGGAGGGGCCCCTACAAGG + Intergenic
993898827 5:93570924-93570946 CCCTTGTAGGGGCCCCTCCGAGG - Intergenic
994497902 5:100535975-100535997 GCCTCGGTGGGGCACCCCCGTGG + Intronic
998853718 5:146375123-146375145 GCCTCCCTGGGGACCCTCTGAGG + Intergenic
1001330661 5:170760198-170760220 GTCTGGCAGGGGCCCCTGTGGGG + Intergenic
1001643867 5:173265494-173265516 ACCTGGCAGGGGCCCCTCTGGGG + Intergenic
1001703312 5:173723006-173723028 GGCTGGGAGGGGCTTCTCTGCGG + Intergenic
1001722269 5:173866634-173866656 GCCTCAGAGGAGACCATCTGGGG + Intergenic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002073792 5:176696386-176696408 CCCTGGGAGGGGCCATTCTGGGG + Intergenic
1002232939 5:177782235-177782257 CCCTCTGAGGGTGCCCTCTGAGG + Exonic
1002232940 5:177782236-177782258 GCCTCAGAGGGCACCCTCAGAGG - Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1002564053 5:180100138-180100160 GCCTCTGCCGGGCCCTTCTGGGG + Intergenic
1005243040 6:23853918-23853940 GCCCTGGATGGGCCCCCCTGTGG - Intergenic
1008153876 6:47989814-47989836 GCCCCGGTGGGGCCTCTCTGTGG - Intronic
1009398803 6:63230608-63230630 GCCCTGGATGGGCCCCCCTGTGG + Intergenic
1010141773 6:72621719-72621741 GCCTCGGAGAGGGGCTTCTGGGG + Intergenic
1013760061 6:113507772-113507794 CCAACGGTGGGGCCCCTCTGAGG - Intergenic
1017375487 6:153762833-153762855 GCCTCAGTGGGGACTCTCTGTGG + Intergenic
1018665087 6:166127930-166127952 GCCTGGGAGGGGCTCCACTCAGG - Intergenic
1018960344 6:168442921-168442943 TCCTCTGAGGGCCCCCTCTGGGG - Intronic
1019527526 7:1487433-1487455 GCCTCCGGGGGGGCCCCCTGAGG + Exonic
1019594657 7:1852869-1852891 GCCTGGAAGGGGCGCCTCCGAGG + Intronic
1020162244 7:5781459-5781481 CTCTCTGAGGGGCGCCTCTGTGG - Intronic
1023888125 7:44375171-44375193 CCCTGGGAGGGTCCCCTCAGAGG - Intergenic
1024074570 7:45811957-45811979 GCGTGGGAGGGGCCGCTGTGAGG - Intergenic
1025052792 7:55743472-55743494 GCGTGGGAGGGGCCCGTGTGAGG + Intergenic
1025052803 7:55743505-55743527 GCGTGGGAGGGGCCCGTGTGAGG + Intergenic
1025129552 7:56368346-56368368 GCCTGGGAGGGGCCGGTGTGAGG + Intergenic
1026045806 7:66904521-66904543 GGCCCGGAGGGGCCACTGTGGGG - Intergenic
1026671386 7:72393619-72393641 GCCTGGGGGGGGCCCAGCTGTGG - Intronic
1029407319 7:100383319-100383341 GCCTTGGAGGACCCCATCTGTGG - Intronic
1035283593 7:157792730-157792752 GCCTCCGGGTGGCCCATCTGCGG - Intronic
1035418054 7:158705464-158705486 GCCTCCGAGGGTCCCCGCTAAGG - Intergenic
1035479057 7:159167516-159167538 CCCTCGGAGGGACAGCTCTGGGG - Intergenic
1035549446 8:509266-509288 GCCCCAGAGGGGACTCTCTGTGG + Intronic
1035655071 8:1299253-1299275 GCCTCGGGTGGGGGCCTCTGTGG - Intergenic
1038373188 8:27012643-27012665 GCCCTGGATGGGCCCCCCTGTGG + Intergenic
1040079634 8:43274344-43274366 GCTGAGGAGGGTCCCCTCTGGGG - Intergenic
1045464373 8:102456140-102456162 TCCTAGGAGGGACCCCTTTGAGG + Intergenic
1048726132 8:137387260-137387282 GCCTCAGTGGGGACCCTGTGTGG + Intergenic
1049180512 8:141219717-141219739 GGCACGGATGGGCCCCTCGGTGG + Exonic
1049555083 8:143277640-143277662 GCCTCGGAGGAGCCAGGCTGGGG - Intergenic
1049788793 8:144463571-144463593 GCCTGGCAGGTGGCCCTCTGGGG - Intronic
1052179003 9:25502104-25502126 GCCCCAGTGGGGACCCTCTGTGG - Intergenic
1052641197 9:31167430-31167452 GGCTAGGAGGAGCCCTTCTGGGG - Intergenic
1056020462 9:82433402-82433424 GCCTTGGATGGGCCTCCCTGTGG + Intergenic
1056088947 9:83185705-83185727 GCCTCTGAGGGGACTCTCTAAGG + Intergenic
1056571971 9:87824611-87824633 GCCTCGGATGGGTCCCTCTGTGG - Intergenic
1057071437 9:92103906-92103928 GCCCTGGATGGGCCCCCCTGTGG - Intronic
1057136066 9:92688753-92688775 GCCTCGGAAGGGCTCCTGAGTGG + Intergenic
1057390547 9:94638913-94638935 ACCTTGGAGGGGCCCACCTGGGG - Intronic
1059468385 9:114484199-114484221 GCCTCGGAGGGGCAGCCCTCTGG - Intronic
1060544598 9:124452684-124452706 GCCAAAGAGAGGCCCCTCTGCGG + Exonic
1061307954 9:129743235-129743257 ACCGCAGAGGGGCCCCTCCGAGG + Intronic
1061307955 9:129743236-129743258 GCCTCGGAGGGGCCCCTCTGCGG - Intronic
1061864675 9:133486049-133486071 GCCACCCAGGGGCCCCGCTGGGG - Intergenic
1061878042 9:133554657-133554679 GCCTGCGAGGGGCCCCCCAGGGG + Exonic
1062581125 9:137229709-137229731 GCCTCGGCGGGGCCTGCCTGAGG + Intergenic
1203792610 EBV:159872-159894 GCCACGGAGCGGCTCTTCTGCGG - Intergenic
1187969665 X:24647136-24647158 GCCTGGGAGGAGACTCTCTGAGG - Exonic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1190259060 X:48786658-48786680 GCCTTGGTGGGGGCTCTCTGGGG - Intronic
1190909624 X:54758915-54758937 GCCTGGGAGGGGCCCCAGTGTGG - Exonic
1191594138 X:62923468-62923490 TCCTCCTAGGGGCCCCTCTCAGG - Intergenic
1191783987 X:64897667-64897689 GCCCCAGAGGGGACCCTGTGTGG + Intergenic
1194374261 X:93112657-93112679 GCCTGGCAGGGCCCCCTTTGGGG - Intergenic
1198051688 X:132957635-132957657 GGCCCGGAGGGGTCCCACTGGGG - Intronic
1199680229 X:150219423-150219445 GGCCCGAAGGGGCCCCTCTCAGG - Intergenic
1200071262 X:153530621-153530643 GCCCCGGAGGGGCCACCTTGGGG - Intronic
1200682288 Y:6226725-6226747 GCCTGGCAGGGCCCCCTTTGGGG - Intergenic