ID: 1061309349

View in Genome Browser
Species Human (GRCh38)
Location 9:129752219-129752241
Sequence GCAGAATGCAGAAAGACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061309349 Original CRISPR GCAGAATGCAGAAAGACCCC AGG (reversed) Intronic
905813395 1:40929709-40929731 GCAGAACCAAGAATGACCCCAGG + Intergenic
906258503 1:44368485-44368507 TCAGAATGCAGGAAGAACCAAGG + Intergenic
907757512 1:57325176-57325198 GCAGAAGGCAGACAGACCAGAGG + Intronic
908090155 1:60677352-60677374 GAGGAATGGAGAAAGACCACTGG - Intergenic
908871741 1:68620718-68620740 GCACAAAGCAGAAAGGCCCTGGG + Intergenic
910862495 1:91755763-91755785 GCAGACTGAAGAAAGAATCCAGG + Intronic
911266916 1:95753742-95753764 GCAGGAGGCAGAAAGGCTCCTGG + Intergenic
915609523 1:156980053-156980075 TCAGAATGGGCAAAGACCCCAGG + Intronic
916370912 1:164093122-164093144 GCATAAAGCAGCAAGACCCAGGG + Intergenic
917479120 1:175395407-175395429 CTAGAATTCAGAAAGCCCCCGGG - Intronic
918059598 1:181049682-181049704 GCAGGAGCCAGAAATACCCCTGG - Intronic
918300303 1:183197947-183197969 TCAGAAGGCAGACAGACACCTGG + Intronic
918305146 1:183239464-183239486 CCAGCAAGCAGAAAGAGCCCTGG + Exonic
918853587 1:189722400-189722422 GCAGACTTCAGAGAGACCACAGG - Intergenic
918983736 1:191596407-191596429 GCAGGAGGCAGAAAGGCTCCTGG - Intergenic
920099213 1:203506563-203506585 GCTGAATACAGAAAGTCACCTGG + Intronic
920507428 1:206526363-206526385 GCAGGATGCTGAATGCCCCCAGG + Intronic
920758931 1:208762891-208762913 GGAGAAGGCAGAAAGAGCTCAGG + Intergenic
921329795 1:214024165-214024187 GCAGATTGCAGAATGAACTCGGG - Intronic
921675202 1:217968651-217968673 GCAGGAGGCAGACAGACTCCTGG + Intergenic
922337253 1:224627802-224627824 GCAGAAAGCAGGCAGCCCCCTGG - Intronic
922348259 1:224715157-224715179 GCAGAATGAAAAATGCCCCCTGG - Intronic
922586457 1:226737729-226737751 GCAGAACCCAGAGAGAGCCCCGG + Intronic
922762944 1:228143660-228143682 GCTGAATGGATAAAGAACCCTGG + Intronic
923202836 1:231728651-231728673 GCAGATGGAAGAAAGACCTCAGG - Intronic
923219051 1:231876310-231876332 GCAGAAGGCAAAAAGAGGCCAGG - Intronic
923402230 1:233626244-233626266 GAAGAGTGAAGAATGACCCCCGG + Intronic
1064090509 10:12379290-12379312 GCATCATGCAGACAGATCCCTGG - Intronic
1065190938 10:23208461-23208483 GAAAAATGCAGACAGACCTCAGG + Intronic
1065521331 10:26576101-26576123 GCAGAATGTTGAAATACCACAGG + Intergenic
1065527074 10:26633540-26633562 GCAGAATGTTGAAATACCACAGG + Intergenic
1065559688 10:26949981-26950003 GCAGAATGCTGAAATACCACAGG - Intergenic
1067188045 10:44046717-44046739 GCAGGAGCCAGAAAGGCCCCCGG + Intergenic
1068213494 10:53952668-53952690 GCAGAAGGCAGACAGGCTCCTGG - Intronic
1068300475 10:55131953-55131975 GCAGGATGCAGACAGGCTCCTGG - Intronic
1069561801 10:69435943-69435965 GCAGGAGGCAGATAGACTCCTGG - Intergenic
1070420447 10:76231449-76231471 GGAGAATGCAGAGAGACCCAAGG + Intronic
1071301462 10:84258771-84258793 ACAGGATTCAGAAAGACACCAGG + Exonic
1071510848 10:86261709-86261731 GCTGGATGCAGCAAAACCCCAGG + Intronic
1071518948 10:86317120-86317142 GCAGAAGGCAGAACTCCCCCCGG + Intronic
1071819428 10:89264868-89264890 GCAGGAAGCAGATAGGCCCCTGG - Intronic
1071957047 10:90770790-90770812 GCAGGAGGCAGAAAGGCTCCTGG + Intronic
1072154754 10:92714660-92714682 GCAGAAGGCAGACAGATTCCTGG - Intergenic
1072158114 10:92742377-92742399 GCAGCATGCATGAAGGCCCCAGG + Intergenic
1073244784 10:102082072-102082094 GCAGCATGCAGAAATGCCCCAGG - Intergenic
1074247976 10:111713847-111713869 GCAGAAAGCAGATAGGCTCCTGG - Intergenic
1074577568 10:114684717-114684739 GCAGAATGCAGGAAAATCCTAGG - Intronic
1074858907 10:117494771-117494793 TCAGAGGGCAGAAAGACCACGGG + Intergenic
1075717412 10:124565064-124565086 GCAGAATGCATAAAGATGCATGG - Intronic
1076259970 10:129057720-129057742 GCACTATGCAGAGAGAGCCCCGG + Intergenic
1077917141 11:6618818-6618840 GCAGAATGTGGAAAGACTCTCGG - Exonic
1080364563 11:31557592-31557614 GTAGAATCCAGAAATACCTCAGG + Intronic
1080502189 11:32881376-32881398 GCAGAATGTAGAAAGACACATGG + Intergenic
1080529549 11:33161586-33161608 GCAGAAAGCAGCGAGATCCCGGG + Intronic
1080685895 11:34514479-34514501 GCAGAATGCAAAAAGGCACAGGG - Intergenic
1080978984 11:37377482-37377504 GCACAAAGCAGTAAGACCCTGGG + Intergenic
1084089161 11:66869099-66869121 ACAGATGGCAGACAGACCCCAGG + Intronic
1085510956 11:77087991-77088013 GGAGAATGGAGAATGTCCCCAGG + Intronic
1085800215 11:79582422-79582444 GCACAATGCAGAAAAAGCACTGG + Intergenic
1086747058 11:90441892-90441914 GCAGAAAGCAGAAAGAAGACTGG - Intergenic
1086865199 11:91971947-91971969 GAAGAATTCTGAAAGACCACTGG + Intergenic
1088828562 11:113516029-113516051 GCAGGACTCTGAAAGACCCCAGG + Intergenic
1089219929 11:116862273-116862295 GCAGATTGATGAAAGAACCCTGG - Exonic
1089309426 11:117547993-117548015 ACATAAGGCAGAAAGACCCGTGG - Intronic
1093375138 12:18416587-18416609 GCAGAATTCTGAAGCACCCCAGG - Intronic
1093494491 12:19740608-19740630 GCAGAATGGGAAAAGACCCAAGG + Intergenic
1095371047 12:41467757-41467779 TCATAATGCAGAAAGCCCCAGGG + Intronic
1096239368 12:49951383-49951405 GCAGGATGCAGACAGACTGCTGG + Intronic
1097145176 12:56935018-56935040 CCAGAAAGCAGAAAGACCTGGGG + Intergenic
1097715464 12:62961366-62961388 GCAGAATGAAGAAAAACTCCTGG - Intergenic
1098597865 12:72294714-72294736 GCAGGAGGCAGAAAGATTCCTGG - Intronic
1099633629 12:85182863-85182885 GGAGAAAGCAGAAAGGCCCGAGG + Intronic
1099938111 12:89152450-89152472 GCATAATTCTGAAGGACCCCAGG - Intergenic
1101816360 12:108149118-108149140 GTAAAATTCACAAAGACCCCTGG + Intronic
1101839309 12:108316514-108316536 GCAGGGTGAAGAAAGTCCCCAGG + Intronic
1102291649 12:111705631-111705653 GCAGAGAGCAGAAGGACGCCAGG + Intronic
1104766703 12:131334309-131334331 GGAGGATGCACAGAGACCCCAGG + Intergenic
1106222139 13:27755095-27755117 GCACATGGCAGCAAGACCCCTGG - Intergenic
1107944590 13:45406602-45406624 GGGAAATGCAGAAAGACACCCGG - Intronic
1110706612 13:78606127-78606149 GGAGATTGCAGGAAGATCCCTGG + Intergenic
1111002649 13:82205552-82205574 GCAGGAGGCAGACAGACTCCTGG + Intergenic
1111213373 13:85109378-85109400 GCAGAAGGCAGACAAACCCTAGG - Intergenic
1111351181 13:87033673-87033695 GGAGAATGAAGAAAGACACCCGG - Intergenic
1114839734 14:26249075-26249097 GCACAAAGCAGCAAGGCCCCAGG - Intergenic
1115534843 14:34363367-34363389 TCAGAATGCAAAGTGACCCCAGG - Intronic
1116863271 14:50011246-50011268 TCAGGATGGAGAACGACCCCAGG - Intergenic
1118378852 14:65201419-65201441 TCAGAATGGAGAAATTCCCCTGG + Intergenic
1119036150 14:71231710-71231732 GTAGAAGGCAGACAGACTCCTGG + Intergenic
1119401468 14:74365496-74365518 GCAGAAGGCAGAAAGGTCACAGG + Intergenic
1120212526 14:81647697-81647719 TCATAATGAAGAAAGACTCCAGG - Intergenic
1120405087 14:84084286-84084308 GCACAAAGCAGCAAGACCCTGGG + Intergenic
1120993872 14:90400411-90400433 GCAGATTACTGAAAGACCCATGG - Intronic
1121275137 14:92662306-92662328 GCAGAAAGGAGACAGAGCCCCGG + Intronic
1121790950 14:96699255-96699277 GCAGAATGGGGAAACACCCAGGG + Intergenic
1121824695 14:97000759-97000781 GCAGGATGCAGACAGATTCCTGG - Intergenic
1122790005 14:104180218-104180240 CCTGAATCCTGAAAGACCCCTGG - Intronic
1124023158 15:25942078-25942100 GCAGAATTTAAAATGACCCCAGG - Intergenic
1124415655 15:29471464-29471486 ACAGAAAACAGAGAGACCCCGGG + Intronic
1125241541 15:37582391-37582413 GCAGAAGGCAGACAGGCTCCTGG + Intergenic
1130227321 15:82069133-82069155 ACAGAATTCAGAAACAGCCCTGG + Intergenic
1131047111 15:89323358-89323380 GCAGAATGAGGAAACACCACAGG + Intronic
1131901512 15:97093153-97093175 ACAGAATGCAGAATGAAACCAGG + Intergenic
1133140831 16:3742857-3742879 GCAGCATCCAGAAAGACCCGTGG - Intronic
1133878793 16:9761364-9761386 GCAGAATGCAGGAGGAAACCAGG + Exonic
1133929028 16:10217212-10217234 GCAGAAAGCAGAAAGACTCAAGG + Intergenic
1137903987 16:52300408-52300430 GCAGAATGCAGCAGGTGCCCTGG - Intergenic
1137966566 16:52940029-52940051 AGAGAAGGCAGAAAGAACCCGGG - Intergenic
1138394768 16:56695540-56695562 GCAGAAGGCAGACAGATTCCTGG + Intronic
1139015466 16:62684283-62684305 GCAGAAGGCAGACAGGCTCCTGG + Intergenic
1139648788 16:68351364-68351386 GGAGAGTGCAGAAAGAGTCCGGG - Intronic
1140220757 16:73042232-73042254 GCCGAGTGCAGAAAGACCAAGGG - Intronic
1141715846 16:85726454-85726476 GCAGAGTAGACAAAGACCCCTGG + Intronic
1142520515 17:501449-501471 GCAGAAGGCAGAAAGTCACAGGG + Intergenic
1144202807 17:12956447-12956469 GCAGAATGGAGATAAACCCGAGG - Intronic
1146836717 17:36117043-36117065 CCAGAATGCAGAGGGACCCTGGG - Intergenic
1151988701 17:77560211-77560233 ACAGAATGCACAAAAATCCCAGG - Intergenic
1153051542 18:906528-906550 GCAATATCCAGAAAGACCCCAGG + Intronic
1153139397 18:1954583-1954605 GCAGGAGGCAGACAGACTCCTGG - Intergenic
1153968311 18:10201909-10201931 GCCTTATGCAGAAAGACCTCTGG - Intergenic
1154114128 18:11596296-11596318 GCATAAATCAGAAAGACCTCAGG + Intergenic
1156044684 18:32864305-32864327 GCAGAAAGCAGACAGACAACAGG - Intergenic
1156260465 18:35440977-35440999 TAAGAATGCAGAAAGATACCTGG + Intergenic
1156379141 18:36541659-36541681 GTAAAATGCAGAATGAGCCCAGG + Intronic
1157012652 18:43670203-43670225 GCAGAAAGCAGAAAAACCACTGG + Intergenic
1157536603 18:48463317-48463339 GCAGAATGCAGATAGACCTATGG + Intergenic
1158163214 18:54509014-54509036 GCAGGATACTGAAAGACCACTGG - Intergenic
1158198102 18:54910605-54910627 GCAGAAGGCAGACAGGCTCCTGG - Intronic
1158346742 18:56523709-56523731 GAAGAAAGCAGAAATACCCAGGG - Intergenic
1158714327 18:59864270-59864292 GGAATATGCAGAAAGACTCCTGG - Intergenic
1159152017 18:64533781-64533803 GCACAATGCAGCAAGGCCCTGGG - Intergenic
1159977454 18:74731753-74731775 CCAGGATGCAGAAGGATCCCTGG + Intronic
1160424677 18:78771793-78771815 TCAGACTGCAGAAAGACACCCGG - Intergenic
1160619655 18:80161833-80161855 GCAGAAGCCAGACTGACCCCTGG - Intronic
1162473339 19:10885509-10885531 GAGGACTGCAGAAAGGCCCCTGG + Intronic
1163668335 19:18613361-18613383 GCAGAGTGCGGAAGGAGCCCGGG - Intronic
1166393148 19:42421298-42421320 ACAGTATGGAGAAAGACCCGAGG - Intronic
925389697 2:3486708-3486730 GTAGACTGCAGGGAGACCCCAGG + Intergenic
925389782 2:3486959-3486981 CCAGACTGCAGGGAGACCCCAGG + Intergenic
926046802 2:9716000-9716022 GCAGCATGAAGAAAGAACACAGG + Intergenic
926174736 2:10580577-10580599 GTAGAATGCAGAAGGCTCCCAGG + Intronic
928983791 2:37160920-37160942 GCAGAATACAGAAAGAAGGCCGG + Intergenic
929260700 2:39863875-39863897 GCACACAGCAGAAAGACCCTGGG - Intergenic
929930529 2:46252259-46252281 GCTGGATGCAGAAAGACACATGG - Intergenic
931246082 2:60493901-60493923 ACAGGAAGCAGAAGGACCCCTGG + Intronic
932589365 2:73054916-73054938 GGAGAATCCAGACAGAGCCCAGG + Intronic
932849504 2:75171157-75171179 GCACAAAGCAGCAAGGCCCCTGG - Intronic
932891900 2:75604817-75604839 GCAGGGGGCAGAAAGGCCCCTGG - Intergenic
933616266 2:84485329-84485351 GCAGGATGCAGGTAGAACCCTGG + Intergenic
935687433 2:105696594-105696616 GCAGAATGCAGAGAGATGACTGG - Intergenic
937008894 2:118543973-118543995 GCACACAGCAGAAAGACCCTGGG - Intergenic
938722104 2:134076279-134076301 GCAGAAAGCAGACAGACTTCTGG - Intergenic
938768322 2:134478900-134478922 GCATAAGGCAGCAAGAGCCCTGG - Intronic
940845278 2:158634268-158634290 ACAGCATTCAGAAGGACCCCAGG + Exonic
942234292 2:173889423-173889445 GCACAAAGCAGCAAGACCCCTGG - Intergenic
943998040 2:194796953-194796975 GCAGAAAGCAGCAAGACTCTGGG - Intergenic
944274019 2:197815246-197815268 GCATAATTCATAAAGACCCTAGG - Intronic
944608899 2:201380167-201380189 GCATAAAGCAGAGAGAACCCAGG - Exonic
945240468 2:207671909-207671931 GCCAAATGCAGTAAGAACCCTGG - Intergenic
945770420 2:214035356-214035378 GCAGAAAGCAGACAGGCTCCTGG - Intronic
946245053 2:218382697-218382719 AGAGAATGCAGAGAGACCCTAGG - Intronic
948180568 2:235976696-235976718 GGAGAAAGCAGAAACACGCCGGG + Intronic
948252884 2:236544644-236544666 GCAGAATGAAGACGGTCCCCGGG + Intergenic
948348675 2:237320769-237320791 CAAGAAAGCAGGAAGACCCCAGG + Intergenic
948476132 2:238221142-238221164 GCAGAAGGCAGACAGATTCCTGG - Intergenic
948982107 2:241499627-241499649 GCCAAATGCAGGAAGAGCCCTGG - Intronic
1170004143 20:11647048-11647070 GCAGGATGCAGACAGGCTCCTGG + Intergenic
1170327836 20:15176265-15176287 GCAGAAGGCAGACAGGCTCCTGG + Intronic
1174074395 20:47922521-47922543 GCAGAATTGAGCAAGGCCCCAGG + Intergenic
1174377028 20:50133105-50133127 GGAGACTGCAGAAAAGCCCCTGG + Intronic
1175293353 20:57892894-57892916 TCAGAAGGCAGAAAGAGTCCTGG - Intergenic
1175302175 20:57950852-57950874 GCAGGCTGCAGAGAGGCCCCTGG + Intergenic
1175694406 20:61090670-61090692 GCAGGATGCAGCAAGCCACCTGG - Intergenic
1178361586 21:31952949-31952971 GGAGAATCCAGAAAGCCCCTGGG + Intronic
1178931256 21:36820737-36820759 GCAGAAGGCAGACAGGCTCCTGG + Intronic
1179519163 21:41931126-41931148 AGAGAATGCAGAGAGAGCCCCGG + Intronic
1179635326 21:42704883-42704905 GTGCAATGCAGAAACACCCCAGG + Intronic
1180134857 21:45855694-45855716 GCAGAAGGCAGACAGACACGTGG - Intronic
1180904012 22:19395703-19395725 CCAGAGTGCAGAAACAGCCCAGG - Intronic
1182433208 22:30312990-30313012 GGAGACTGCAAAAAGACCCCAGG + Intronic
1182887635 22:33789135-33789157 GCAGAAAGCAGCAAGGCCCTGGG - Intronic
1184257036 22:43293140-43293162 GCAGGCTGGAGACAGACCCCAGG - Intronic
1184359591 22:44007022-44007044 GCAAAAGGCACAAAGATCCCAGG + Intronic
1184697718 22:46149558-46149580 GCGGAATGCACAAAGCCCCTGGG - Intergenic
1184956076 22:47887029-47887051 GCACAATGAAGAAAGACCTCAGG - Intergenic
949675493 3:6448258-6448280 GCAGAAGGCAGACAGACACTAGG - Intergenic
950469982 3:13178582-13178604 GCAGAGAGCAGTAAGCCCCCTGG + Intergenic
950731668 3:14964918-14964940 GCACAAGGCAGAAACACTCCTGG + Intronic
951092569 3:18591705-18591727 GCATGATGAAGAAAGACCACAGG - Intergenic
952409898 3:33038695-33038717 TCAGAACGGAGAAAGAACCCTGG + Intronic
952514648 3:34091655-34091677 CCAGAATGCAGAAAAGCCCTAGG - Intergenic
953549015 3:43886019-43886041 GCAGAAAGCAGCAAGTTCCCTGG - Intergenic
953790836 3:45946712-45946734 GCAGAGTGCAGACAAACACCAGG - Exonic
954134785 3:48576956-48576978 GCAGAGACCAGAGAGACCCCAGG + Intronic
955103445 3:55873874-55873896 TCAGAATGCAGAATGACAGCTGG - Intronic
955260381 3:57383545-57383567 AGAGAATGCAGAAAGATCACAGG + Intronic
956856796 3:73283021-73283043 GCACAATCCAGAAAGACCTCTGG + Intergenic
957426992 3:80051662-80051684 GCAGAAGGCAGACAGGCTCCTGG + Intergenic
958045717 3:88281569-88281591 TTAGAATGCAGAAACATCCCAGG - Intergenic
958570227 3:95871297-95871319 GCAAAATGCAGAAAGAACCCTGG + Intergenic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
962565316 3:136652015-136652037 GCAGAAAGTAGAAAGATCACAGG + Intronic
964514945 3:157497711-157497733 GGAGTGTGCAGAAAGAGCCCAGG - Intronic
965087183 3:164113923-164113945 GCAGAAGTCAGACAGGCCCCTGG + Intergenic
965496630 3:169406349-169406371 ACTGAATGCAGAGAGCCCCCAGG + Intronic
966334389 3:178852177-178852199 ACAGAATGCAGAAAGGGGCCTGG - Intergenic
967223274 3:187267301-187267323 GCAGATTTCAGAAAGGCTCCAGG - Intronic
968809954 4:2795313-2795335 ACAGAACGCAGGAAGACCCAGGG - Intronic
968842427 4:3017236-3017258 GCAGAGTGCAGTCAGACCCCAGG - Intronic
969042414 4:4309650-4309672 GCAGAAGGCACTAGGACCCCCGG - Intronic
970284918 4:14501307-14501329 GAAGGATGCAGAAAGACACAAGG + Intergenic
971260772 4:25054723-25054745 ACAGAAGGCAGAAAGGCCCTGGG + Intergenic
973762652 4:54133729-54133751 GCAGTATGCAGAAAGACAAAGGG - Intronic
974171336 4:58270600-58270622 GCACAAAGCAGCAAGACCCTGGG - Intergenic
976311079 4:83614082-83614104 ACAGAATGAAGAAAGACTACAGG - Intergenic
976922685 4:90457838-90457860 GCAGAAAGCAGATAGGCTCCTGG - Intronic
978248590 4:106604377-106604399 GCAGGATGCAGACAGGCTCCTGG - Intergenic
978498447 4:109384551-109384573 GCAGAAGGCAGACAGGCTCCTGG + Intergenic
979333709 4:119444685-119444707 GAAGTTTGCTGAAAGACCCCTGG - Intergenic
979545944 4:121940041-121940063 GCACACTGCAGAAAGAGGCCGGG - Intronic
980469555 4:133233908-133233930 ACACCATGCACAAAGACCCCTGG - Intergenic
982265586 4:153535477-153535499 TCTGAATGCAGAGACACCCCAGG - Intronic
983048185 4:163011507-163011529 GCACAAAGCAGCAAGGCCCCAGG + Intergenic
983561202 4:169103405-169103427 GCAAAATGCAGAAGGAGCCCAGG - Intronic
983789934 4:171783610-171783632 GCACAAAGCAGCAAGACCCTGGG + Intergenic
985188601 4:187346094-187346116 GCAGACTGCAGAATAACCACAGG - Intergenic
986455328 5:7912506-7912528 GCAGACAGCAGAGAGACCCTGGG + Intergenic
986591715 5:9377324-9377346 GCTAAATGCAGAAAGAGCTCTGG + Intronic
986739957 5:10697203-10697225 GCAGTATTCAGAAAGGCTCCTGG + Intronic
989051970 5:37330400-37330422 CTAGAAAGCAGAAAGACCACAGG - Intronic
989537597 5:42582192-42582214 GCAGAAGGCAGACAGGCTCCTGG + Intronic
989999306 5:50874492-50874514 GAAGGATGCAGAAAGACACGTGG - Intergenic
990023717 5:51159913-51159935 GCAGAAGGCAGACAGGCTCCTGG + Intergenic
991043608 5:62200232-62200254 GCAGAATGGAGAAAAACCACAGG + Intergenic
993211872 5:84962099-84962121 GCAGGAGGCAGACAGGCCCCTGG - Intergenic
995046582 5:107655982-107656004 GCAGAATTCAGAAAAATCCAAGG + Intronic
995680218 5:114708908-114708930 ACAGACTGCAGAAAGGCACCAGG + Intergenic
996294148 5:121891164-121891186 GCAGGAGGCAGAAAAATCCCAGG - Intergenic
1000929277 5:167231882-167231904 GCAGAAAGCAGAAAGGCCCGGGG - Intergenic
1002026717 5:176400845-176400867 GCTGAATGAGCAAAGACCCCTGG + Intronic
1003105498 6:3211889-3211911 CAAGAATGCAGAAAGGCTCCTGG + Intergenic
1003204658 6:3996513-3996535 GCAGAATGGAGACAGACACCAGG + Intergenic
1004903546 6:20215062-20215084 GCATAATGAATAAAGAGCCCAGG - Intergenic
1006355891 6:33557591-33557613 GCAGCAGGCAGGAAGAACCCAGG - Intergenic
1006406547 6:33848909-33848931 GAAGAATGAAGAGTGACCCCGGG - Intergenic
1006444248 6:34069929-34069951 GCCCCAGGCAGAAAGACCCCAGG - Intronic
1006514617 6:34539070-34539092 ACAGATTGCACACAGACCCCAGG + Intronic
1007496826 6:42265894-42265916 GCAGACAGCAGAAAGAGTCCTGG - Intronic
1007820243 6:44555673-44555695 GCAGAATGAAGGAAGAACCCAGG - Intergenic
1008220900 6:48852406-48852428 GCACAAAGCAGCAAGGCCCCGGG + Intergenic
1008440894 6:51530832-51530854 GCAGAAGGCAGAAGTACCCCTGG - Intergenic
1009243385 6:61205050-61205072 GCAGGATGCAGACAGGCTCCTGG - Intergenic
1010519683 6:76817913-76817935 GCAGAAGGCAGACAGGCTCCTGG + Intergenic
1011195896 6:84779016-84779038 GCAGAAAGGAGAAAGACACATGG + Intergenic
1011530190 6:88312701-88312723 GCAGGAGGCAGAGAGACTCCTGG - Intergenic
1011930713 6:92708562-92708584 AGAGAATGCAGAAAAAACCCAGG + Intergenic
1017043065 6:150323338-150323360 GCGCAATGCAGATAGACCCAGGG + Intergenic
1018669175 6:166165910-166165932 CCAGGATGCAGAAAGTCCTCTGG + Intronic
1018685455 6:166300742-166300764 TCAGAATGCAGACAGACGGCTGG + Intergenic
1019176035 6:170160023-170160045 GCAGAACGTAGACAGAACCCGGG + Intergenic
1019897963 7:3997829-3997851 GCAGGAGGCAGACAGACTCCTGG - Intronic
1020586746 7:10078942-10078964 GCAAGATGCAGACAGACTCCTGG + Intergenic
1021614047 7:22484342-22484364 GCATAATTCTGAAGGACCCCAGG - Intronic
1024146469 7:46522429-46522451 ACAGGGAGCAGAAAGACCCCAGG + Intergenic
1027432984 7:78133564-78133586 CCAGAAAGAAGAAAGAACCCTGG + Intronic
1028024553 7:85821171-85821193 GCAGAAGGCAGACAGATTCCTGG + Intergenic
1028135171 7:87217559-87217581 GGAGAAGGGAGAGAGACCCCTGG - Intronic
1029575518 7:101400967-101400989 GCAGCCTGCAGAGAGACCACAGG - Intronic
1029689772 7:102173591-102173613 GCAGAATGAAGCAGGACCCCAGG - Intronic
1029961416 7:104692459-104692481 GCACAAAGCAGCAAGACCCTGGG - Intronic
1030243776 7:107359473-107359495 GCAGGAGGCAGAAAGGCTCCTGG + Intronic
1030394300 7:108966267-108966289 GCAGGAGGCAGCAAGATCCCTGG + Intergenic
1031684058 7:124710271-124710293 GTAGGAGGCAGAAAGAACCCTGG - Intergenic
1031823542 7:126533827-126533849 GCAGGCTGCAGACAGACGCCGGG + Exonic
1032929284 7:136647819-136647841 ACAGAATTTAGAAAGACTCCAGG + Intergenic
1035227295 7:157440793-157440815 GCAAGACGCAGAAAGACCGCAGG + Intergenic
1037892776 8:22632365-22632387 CCAGATTCCAGAAAAACCCCAGG - Intronic
1038724753 8:30070921-30070943 GAAAAATGCAAAAAGAACCCAGG + Intronic
1039484910 8:37902863-37902885 GCAGAAGGCAGACAATCCCCAGG - Intergenic
1039503827 8:38037100-38037122 TCATAATGGAGAGAGACCCCAGG - Intronic
1039652109 8:39353391-39353413 GCACAAAGCAGCAAGACCCTGGG - Intergenic
1040725667 8:50379012-50379034 GCAGAATGCAGACAGGTTCCTGG - Intronic
1040836948 8:51742884-51742906 GCAGCATGCTGAAAGAGCACAGG + Intronic
1040902093 8:52427782-52427804 GCAGAAGGCAGAAGGCCCACAGG + Intronic
1044024440 8:87151108-87151130 GCAGGAAGCAGAAAGACTGCAGG + Intronic
1044774980 8:95678302-95678324 GCAGGAGGCAGACAGGCCCCTGG - Intergenic
1045068749 8:98478039-98478061 CCTGAATTCAGACAGACCCCTGG + Intronic
1045218305 8:100171638-100171660 GCTGAATTCAGCAAGACCACAGG + Intronic
1046711038 8:117512004-117512026 GCAGAACACACAAAGCCCCCAGG + Intergenic
1048445013 8:134486694-134486716 ACGGAATGCAGAAAGCCACCAGG + Intronic
1049140468 8:140949759-140949781 GGAGAAGGCAGAAAGGCTCCTGG + Intronic
1051604296 9:18905567-18905589 GCAGAATGCCCACAGACCACAGG + Intronic
1053133659 9:35635618-35635640 GGAGAATGCAGAAAAACCAGAGG - Intronic
1055412809 9:76049573-76049595 GCAGAGTGCAGAATAACCCTGGG + Intronic
1055581080 9:77707252-77707274 GTGGAAAGCAGAAAGACCACTGG - Intergenic
1058342851 9:103920021-103920043 GCAGAATTCAGAATTACCTCAGG - Intergenic
1060002165 9:119968734-119968756 CCAGAAGGCAGGAAGACTCCTGG + Intergenic
1061309349 9:129752219-129752241 GCAGAATGCAGAAAGACCCCAGG - Intronic
1061950400 9:133932845-133932867 GCAGCAGGCAGATGGACCCCTGG - Intronic
1185506105 X:633083-633105 GCTGGGTGCAGAAAGACCCCCGG + Intronic
1186062975 X:5730677-5730699 CCAGAATGCAGAAAGATGCATGG + Intergenic
1186509318 X:10118576-10118598 GCAGGACGCAAAAACACCCCTGG - Intronic
1187662560 X:21566007-21566029 ATAGAGTGCGGAAAGACCCCTGG - Intronic
1188207748 X:27380772-27380794 GCAGGAGGCAGACAGACTCCAGG + Intergenic
1189573180 X:42321384-42321406 GAAGAATCCAGAAGGACCACTGG + Intergenic
1190974506 X:55386468-55386490 GCAGAAAGCAGCAAGGCCCTGGG - Intergenic
1190982944 X:55472846-55472868 GCAAAATGCAGAAATAACCTGGG + Intergenic
1190985755 X:55500337-55500359 GCAAAATGCAGAAATAACCTGGG - Intergenic
1193417434 X:81241312-81241334 GCAGAAGGCAGACAGTCTCCGGG + Intronic
1195235301 X:102890691-102890713 GCAGAGTGGAGGAGGACCCCAGG + Intergenic
1198442120 X:136673328-136673350 GCTGAATGCAGTAAGAGCCGAGG + Intronic
1199112789 X:143955142-143955164 GCACAAAGCAGAAAGGCCCTAGG - Intergenic
1199606523 X:149583664-149583686 GCAGACTGCAGGCAGAGCCCCGG + Intronic
1199632599 X:149785704-149785726 GCAGACTGCAGGCAGAGCCCCGG - Intronic
1200252427 X:154560642-154560664 TCAGAAGGCAGAAAGAACCATGG - Intronic
1200265340 X:154643774-154643796 TCAGAAGGCAGAAAGAACCATGG + Intergenic