ID: 1061310003

View in Genome Browser
Species Human (GRCh38)
Location 9:129755900-129755922
Sequence CCAGAGATAAAACGTGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061310003_1061310008 29 Left 1061310003 9:129755900-129755922 CCTGAGACACGTTTTATCTCTGG No data
Right 1061310008 9:129755952-129755974 CTTCTGGCTGATATTTCTGTCGG No data
1061310003_1061310006 -9 Left 1061310003 9:129755900-129755922 CCTGAGACACGTTTTATCTCTGG No data
Right 1061310006 9:129755914-129755936 TATCTCTGGTTGTCTGTTGGAGG No data
1061310003_1061310007 13 Left 1061310003 9:129755900-129755922 CCTGAGACACGTTTTATCTCTGG No data
Right 1061310007 9:129755936-129755958 GAGCTGTGCAAGCTCGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061310003 Original CRISPR CCAGAGATAAAACGTGTCTC AGG (reversed) Intergenic
No off target data available for this crispr