ID: 1061315134

View in Genome Browser
Species Human (GRCh38)
Location 9:129790707-129790729
Sequence ATGGAAAGAAGGCCTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061315134_1061315142 22 Left 1061315134 9:129790707-129790729 CCTTTCCCAGGCCTTCTTTCCAT No data
Right 1061315142 9:129790752-129790774 GCTGGTAGTTTTGAATGTTTTGG No data
1061315134_1061315140 4 Left 1061315134 9:129790707-129790729 CCTTTCCCAGGCCTTCTTTCCAT No data
Right 1061315140 9:129790734-129790756 GATGGCCTCGACGAGTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061315134 Original CRISPR ATGGAAAGAAGGCCTGGGAA AGG (reversed) Intergenic
No off target data available for this crispr