ID: 1061315139

View in Genome Browser
Species Human (GRCh38)
Location 9:129790726-129790748
Sequence CTCGTCGAGGCCATCATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061315139_1061315142 3 Left 1061315139 9:129790726-129790748 CCATTTATGATGGCCTCGACGAG No data
Right 1061315142 9:129790752-129790774 GCTGGTAGTTTTGAATGTTTTGG No data
1061315139_1061315143 26 Left 1061315139 9:129790726-129790748 CCATTTATGATGGCCTCGACGAG No data
Right 1061315143 9:129790775-129790797 ATTGACAATTTAAATGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061315139 Original CRISPR CTCGTCGAGGCCATCATAAA TGG (reversed) Intergenic
No off target data available for this crispr