ID: 1061315142

View in Genome Browser
Species Human (GRCh38)
Location 9:129790752-129790774
Sequence GCTGGTAGTTTTGAATGTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061315141_1061315142 -10 Left 1061315141 9:129790739-129790761 CCTCGACGAGTAAGCTGGTAGTT No data
Right 1061315142 9:129790752-129790774 GCTGGTAGTTTTGAATGTTTTGG No data
1061315135_1061315142 17 Left 1061315135 9:129790712-129790734 CCCAGGCCTTCTTTCCATTTATG No data
Right 1061315142 9:129790752-129790774 GCTGGTAGTTTTGAATGTTTTGG No data
1061315138_1061315142 11 Left 1061315138 9:129790718-129790740 CCTTCTTTCCATTTATGATGGCC No data
Right 1061315142 9:129790752-129790774 GCTGGTAGTTTTGAATGTTTTGG No data
1061315136_1061315142 16 Left 1061315136 9:129790713-129790735 CCAGGCCTTCTTTCCATTTATGA No data
Right 1061315142 9:129790752-129790774 GCTGGTAGTTTTGAATGTTTTGG No data
1061315134_1061315142 22 Left 1061315134 9:129790707-129790729 CCTTTCCCAGGCCTTCTTTCCAT No data
Right 1061315142 9:129790752-129790774 GCTGGTAGTTTTGAATGTTTTGG No data
1061315139_1061315142 3 Left 1061315139 9:129790726-129790748 CCATTTATGATGGCCTCGACGAG No data
Right 1061315142 9:129790752-129790774 GCTGGTAGTTTTGAATGTTTTGG No data
1061315133_1061315142 27 Left 1061315133 9:129790702-129790724 CCACACCTTTCCCAGGCCTTCTT No data
Right 1061315142 9:129790752-129790774 GCTGGTAGTTTTGAATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061315142 Original CRISPR GCTGGTAGTTTTGAATGTTT TGG Intergenic
No off target data available for this crispr