ID: 1061315143

View in Genome Browser
Species Human (GRCh38)
Location 9:129790775-129790797
Sequence ATTGACAATTTAAATGTCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061315139_1061315143 26 Left 1061315139 9:129790726-129790748 CCATTTATGATGGCCTCGACGAG No data
Right 1061315143 9:129790775-129790797 ATTGACAATTTAAATGTCATAGG No data
1061315141_1061315143 13 Left 1061315141 9:129790739-129790761 CCTCGACGAGTAAGCTGGTAGTT No data
Right 1061315143 9:129790775-129790797 ATTGACAATTTAAATGTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061315143 Original CRISPR ATTGACAATTTAAATGTCAT AGG Intergenic
No off target data available for this crispr