ID: 1061315759

View in Genome Browser
Species Human (GRCh38)
Location 9:129794899-129794921
Sequence TTCACCTGTAGTGCTTAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061315759_1061315760 0 Left 1061315759 9:129794899-129794921 CCGCACTAAGCACTACAGGTGAA No data
Right 1061315760 9:129794922-129794944 CAGAACAAATCCTGCCTTCGAGG No data
1061315759_1061315764 25 Left 1061315759 9:129794899-129794921 CCGCACTAAGCACTACAGGTGAA No data
Right 1061315764 9:129794947-129794969 ACCGTACATTCAAGCAAACAGGG No data
1061315759_1061315763 24 Left 1061315759 9:129794899-129794921 CCGCACTAAGCACTACAGGTGAA No data
Right 1061315763 9:129794946-129794968 TACCGTACATTCAAGCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061315759 Original CRISPR TTCACCTGTAGTGCTTAGTG CGG (reversed) Intergenic
No off target data available for this crispr