ID: 1061316308

View in Genome Browser
Species Human (GRCh38)
Location 9:129798292-129798314
Sequence CTCACGAGGCAGAAGTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061316299_1061316308 27 Left 1061316299 9:129798242-129798264 CCTGGTGAAGGTTGCCTTCTGCT No data
Right 1061316308 9:129798292-129798314 CTCACGAGGCAGAAGTGGAAGGG No data
1061316303_1061316308 -8 Left 1061316303 9:129798277-129798299 CCTTCTTGCTGTGTCCTCACGAG No data
Right 1061316308 9:129798292-129798314 CTCACGAGGCAGAAGTGGAAGGG No data
1061316301_1061316308 13 Left 1061316301 9:129798256-129798278 CCTTCTGCTTCCAAAATGGTGCC No data
Right 1061316308 9:129798292-129798314 CTCACGAGGCAGAAGTGGAAGGG No data
1061316302_1061316308 3 Left 1061316302 9:129798266-129798288 CCAAAATGGTGCCTTCTTGCTGT 0: 2
1: 8
2: 61
3: 198
4: 470
Right 1061316308 9:129798292-129798314 CTCACGAGGCAGAAGTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061316308 Original CRISPR CTCACGAGGCAGAAGTGGAA GGG Intergenic
No off target data available for this crispr