ID: 1061316737

View in Genome Browser
Species Human (GRCh38)
Location 9:129801098-129801120
Sequence CAGGATGCACAGAGGCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061316737_1061316742 1 Left 1061316737 9:129801098-129801120 CCCACAGGCCTCTGTGCATCCTG No data
Right 1061316742 9:129801122-129801144 ATTACAGCCTTGGCCCACCCTGG No data
1061316737_1061316740 -9 Left 1061316737 9:129801098-129801120 CCCACAGGCCTCTGTGCATCCTG No data
Right 1061316740 9:129801112-129801134 TGCATCCTGCATTACAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061316737 Original CRISPR CAGGATGCACAGAGGCCTGT GGG (reversed) Intergenic
No off target data available for this crispr