ID: 1061318219

View in Genome Browser
Species Human (GRCh38)
Location 9:129810931-129810953
Sequence CCAGCCCGGTGCTGCCACAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061318219_1061318223 -5 Left 1061318219 9:129810931-129810953 CCTTTGTGGCAGCACCGGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1061318223 9:129810949-129810971 GCTGGACTGCCCTGATCCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 198
1061318219_1061318222 -6 Left 1061318219 9:129810931-129810953 CCTTTGTGGCAGCACCGGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 158
Right 1061318222 9:129810948-129810970 GGCTGGACTGCCCTGATCCCTGG 0: 1
1: 0
2: 3
3: 14
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061318219 Original CRISPR CCAGCCCGGTGCTGCCACAA AGG (reversed) Exonic
900361184 1:2289837-2289859 CCAGCCAGGTGCTGCCCAGAGGG - Intronic
900552258 1:3262787-3262809 CCTGCGGGGTGCTGCCACGATGG + Intronic
901645049 1:10712500-10712522 CCTGCCCTGAGCTGCCACATGGG - Intronic
906518512 1:46453551-46453573 CCAGCACAGGGCTGGCACAAGGG - Intergenic
907325629 1:53637134-53637156 CCAGCCCAGGGCTGGCACAGAGG - Intronic
907382543 1:54103179-54103201 CCACCCCAGAGCTGACACAATGG + Intronic
914982560 1:152427687-152427709 CCAGCTCTGCTCTGCCACAAGGG + Intergenic
916447725 1:164889317-164889339 CCAGCCCAGTGCTGGCTCAATGG + Intronic
919766723 1:201132185-201132207 GCAGCCCAGTGCTGCCACAGAGG - Intergenic
921698944 1:218245339-218245361 CCCTCCCGGGGCTGCCACCAAGG + Intergenic
923681754 1:236124231-236124253 CAAGCCCTGTGCTGCTACAAGGG + Intergenic
1067700396 10:48567394-48567416 CCAGCCCTGGGCTGCCACCAAGG - Intronic
1067756808 10:49011701-49011723 CCAGCTCTGTGCTGCCACAGGGG + Intergenic
1071336005 10:84601054-84601076 CCAGCCCTGTGCTCCCCCATGGG + Intergenic
1073658680 10:105447594-105447616 CCACCTCAGTGCTGGCACAATGG - Intergenic
1076875335 10:133213086-133213108 CCAGGCGGCTGCTGCCTCAATGG + Intronic
1080470815 11:32543796-32543818 TCAGACCGGTGCTCCCAAAAAGG - Intergenic
1081957698 11:47107867-47107889 GCAGCACGCTGCTGCCCCAAGGG - Intronic
1083365632 11:62140097-62140119 CCACCCCGGAGCTGCCAGGAAGG + Intronic
1083452191 11:62753577-62753599 CCATCACGGTGCAGTCACAAAGG + Exonic
1085152664 11:74264587-74264609 CCAGGCCGTTGCTGGCACTAGGG - Intronic
1086845482 11:91744497-91744519 CCATCCCAGTGCTTCCTCAATGG - Intergenic
1089395215 11:118132215-118132237 CCAGCCCCATGCTGACTCAATGG - Intergenic
1090458949 11:126872723-126872745 CCTGCTCTGTGCTGCCAGAATGG + Intronic
1091770400 12:3147569-3147591 CCAGCCCAGTGCTGCAACGATGG + Intronic
1096621773 12:52869827-52869849 ATAGGCTGGTGCTGCCACAAAGG + Intergenic
1102931802 12:116868023-116868045 CCAGCCTGTTTCTGCCACATGGG + Intronic
1103844824 12:123893910-123893932 ACAGCCAGCTGCTGCCACAAAGG + Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1104168660 12:126258473-126258495 CCTGCCCCTTGCTGCCACAGGGG - Intergenic
1107036794 13:35910676-35910698 CCAGGAAGGTGCTGCCACAGCGG - Intronic
1111328587 13:86732099-86732121 TCAGCCCATTGCTGCCACTATGG + Intergenic
1112938046 13:104825279-104825301 CCACCCCAGTGCTGGCATAAGGG - Intergenic
1113533644 13:111047064-111047086 TGAGCCCTGTGCTGCCACAAGGG - Intergenic
1114189584 14:20430247-20430269 CCAACACCGTGCAGCCACAAAGG + Exonic
1115328288 14:32166578-32166600 CCACTCCAGTGCTGGCACAATGG + Intergenic
1118607074 14:67512405-67512427 TTAGCCAGGTGTTGCCACAAAGG + Intronic
1121413856 14:93765323-93765345 CCAGCCCTGTGCTGCCGCTGAGG + Intronic
1121423713 14:93833440-93833462 CCCACCCGGTGTTGCCACATTGG + Intergenic
1121633715 14:95439722-95439744 CCAGCCCTGCGCTTCCACCAGGG + Exonic
1123411703 15:20066325-20066347 CCAGCACAGTGCAGCCACGAAGG - Intergenic
1127390796 15:58503666-58503688 CCAGCCCGGGGTGGCCCCAAAGG + Intronic
1128499103 15:68214729-68214751 CCAGCAAGTTGGTGCCACAACGG - Intronic
1129457383 15:75683099-75683121 CCGGCCCTGGGCTGCCACCAGGG + Intronic
1130274443 15:82469194-82469216 CCGGCCCTGGGCTGCCACCAGGG - Intergenic
1130466790 15:84196568-84196590 CCGGCCCTGGGCTGCCACCAGGG - Intergenic
1130497474 15:84476968-84476990 CCGGCCCTGGGCTGCCACCAGGG + Intergenic
1130589085 15:85201161-85201183 CCGGCCCTGGGCTGCCACCAGGG - Intergenic
1131580536 15:93638588-93638610 CTATCCCTGTGCTGGCACAATGG - Intergenic
1132759566 16:1502187-1502209 ACAGCCTGGTTCTGCCTCAAGGG + Intronic
1133485208 16:6213395-6213417 TCAGCCCAGTGTTGCCAGAATGG - Intronic
1134032697 16:11005213-11005235 CCAGCCCAGTCCTGGCACACAGG + Intronic
1134868667 16:17631845-17631867 CCAGCTCACTGTTGCCACAAGGG + Intergenic
1135782616 16:25317911-25317933 CCACCCCAGTCCTGGCACAATGG - Intergenic
1138589947 16:57994158-57994180 CCAGCCCGGCCCTGCCCCAGAGG - Intergenic
1139262053 16:65603729-65603751 CCAGCACGGTGCTGCCCTACAGG - Intergenic
1139440202 16:66962953-66962975 CCAGACCGGGCCTGCCACTAGGG - Intronic
1139773987 16:69302072-69302094 CCATGCCACTGCTGCCACAAAGG - Exonic
1141590095 16:85062755-85062777 CCAGCCCGGTGCTACCATTTGGG - Intronic
1143432209 17:6895442-6895464 CCTGCCTGGTGCTGCCTCCAGGG + Intronic
1150550727 17:66207421-66207443 CCACCCCAGTGCTGGCATAATGG + Intergenic
1153909394 18:9693602-9693624 CCAGGCGGCTGCTGCCAGAAAGG - Intergenic
1155717908 18:28969865-28969887 CCAGCCTTGTGCTTCCACAAGGG + Intergenic
1157931105 18:51824404-51824426 GTAGCCAGGTGCTTCCACAAAGG + Intergenic
1158104751 18:53873116-53873138 CCAGTCCAGTTCTGCCTCAAAGG + Intergenic
1158705191 18:59786322-59786344 CCAGCCCAGTGTTCCCACCAGGG + Intergenic
1160573384 18:79833742-79833764 CCAGCCAGATGCTGCCACACTGG - Intergenic
1160808675 19:1003512-1003534 CCACCGCGGGGCTGCCACCAGGG + Exonic
1160831631 19:1107202-1107224 CCAGCCAGGTGAGGCCCCAAGGG - Intergenic
1161063125 19:2225184-2225206 CCACCCCTGTTGTGCCACAAGGG - Intronic
1161283066 19:3456199-3456221 CCCGCCCGGTCCTGCCACTGAGG - Intronic
1162070514 19:8149580-8149602 CCAGCCCAGAGCTGCCACTCGGG + Exonic
1163675254 19:18652619-18652641 CCAGCCCAGTGCTGCCACCTGGG + Intronic
1164669151 19:30063158-30063180 CCACCCCCTTGCTGCCACCATGG + Intergenic
1165314009 19:35043918-35043940 CCAGCCCGGAGCTGCCAGGGAGG - Intronic
1167475808 19:49700497-49700519 GAAGCTTGGTGCTGCCACAATGG + Intronic
1168405724 19:56109287-56109309 CCACCCCAGTGCAGCCCCAAAGG + Intronic
1168714198 19:58517749-58517771 CGAGCCCTGTCCTGCAACAAGGG - Intronic
927305314 2:21564780-21564802 CCAGACTGGAGCTGCCACATAGG + Intergenic
927889403 2:26738877-26738899 TCAGCGCTCTGCTGCCACAATGG + Intergenic
931980944 2:67693673-67693695 CCAGCATGGTGCTGTCTCAAGGG + Intergenic
933899106 2:86836421-86836443 CCAGCCCTGTGCTGGGACTAGGG - Intronic
935781447 2:106512805-106512827 CCAGCCCTGTGCTGGGACTAGGG + Intergenic
937302959 2:120854425-120854447 CCTGCCCAGTGCTGCTTCAAGGG + Intronic
938225237 2:129610059-129610081 CCAGCCCCAGGCTGCCACCATGG - Intergenic
940782256 2:157945273-157945295 CTACCCCAGTGCTGGCACAATGG + Intronic
940812969 2:158266327-158266349 CCAGCCAGTTGCTGCCACATAGG + Intronic
942503899 2:176621404-176621426 CCAGTCAGGTGCTGACACATAGG + Intergenic
945246442 2:207721854-207721876 CCAGCCAGGAGCTGCCACCGAGG - Intronic
946936216 2:224723512-224723534 CCAGCCATTTGCTGCCATAAAGG + Intergenic
948874039 2:240818061-240818083 CCAGCCGGGTGCTGCCCCCCTGG - Intronic
1168803791 20:661453-661475 CCAGCCTGTAGCTGCCACCAAGG - Intronic
1172398180 20:34624865-34624887 GCAACCCTGGGCTGCCACAAAGG + Intronic
1172774239 20:37397899-37397921 GGAGCCCGGAGCTGCCACACGGG - Intronic
1173449471 20:43150166-43150188 CCAGCCGGTTGCTGCCATAGAGG - Intronic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1175868320 20:62193512-62193534 CCAGCCGGCTACTGCCACAGCGG + Exonic
1175943815 20:62549772-62549794 CCAGCCAGGCCCTGCCACCAAGG - Intergenic
1176184249 20:63769486-63769508 TGAGCCCGGTGATGCCCCAAGGG + Intronic
1180985626 22:19902545-19902567 CCAGCCCTGTGCTGCCTCCCTGG - Intronic
1183149896 22:36028916-36028938 CCTTCCCGGTGCTGCCACAGTGG - Intergenic
1183255480 22:36758993-36759015 CCAGCCTGGTGCTGTCTTAAGGG + Intronic
1184583800 22:45434357-45434379 CCACCCAGGGGCTGCCAAAAGGG + Intergenic
949876838 3:8631778-8631800 ACAGTCTGGTGCTGCCACACGGG - Intronic
950392784 3:12709815-12709837 CCACCCCAGTTCTGGCACAATGG - Intergenic
950947085 3:16960299-16960321 CCAGCACAGTGCCGCCACACTGG + Intronic
953537553 3:43787653-43787675 CCATCTCTGTGCTGCCAGAATGG - Intergenic
954197692 3:49006243-49006265 CCAGCCCCCGTCTGCCACAATGG + Intronic
957397370 3:79659792-79659814 CCACCCTGGTTCTGGCACAATGG + Intronic
959027086 3:101252137-101252159 CCAGCCACTTTCTGCCACAAGGG + Intronic
960638723 3:119808285-119808307 CCAGCACTGTGCCCCCACAAGGG - Intronic
960987081 3:123287709-123287731 CCAGCCTGGTGATGGCACATGGG - Intronic
961376093 3:126467048-126467070 ACAGCCAGTTGCTGCAACAAAGG + Intronic
962826666 3:139105472-139105494 CCAGCCCGGGGCTGCTTCCAGGG - Intronic
964404422 3:156334222-156334244 CTGACCCTGTGCTGCCACAATGG - Intronic
967381520 3:188864301-188864323 CCAGCACTGTGCTGCCAGAGTGG + Intronic
968541878 4:1172110-1172132 CCACCCCGAGGCTGCCACGACGG - Intronic
968650032 4:1756858-1756880 GCACCCCGGTGCTCCCACACTGG - Intergenic
968650055 4:1756918-1756940 GCACCCCGGTGCTCCCACACTGG - Intergenic
968650078 4:1756978-1757000 GCACCCCGGTGCTCCCACACTGG - Intergenic
968979856 4:3841406-3841428 ACAGCCCCTTGCAGCCACAAAGG + Intergenic
969446735 4:7249183-7249205 CCAGCCCGGTTGAGCCTCAAAGG - Intronic
969538974 4:7774044-7774066 CCAGCCCGGTGCTTAGACTACGG - Intronic
969564918 4:7971848-7971870 CCAGCCCTGTGCTGGTACAGAGG - Intronic
969640881 4:8397737-8397759 CCTGCCCCGTGCTGCCCCATCGG + Intronic
982068974 4:151678661-151678683 CCAGCCCGGTGCGTGCACTATGG + Intronic
985177519 4:187217109-187217131 CCCGCCAGGTCCTGACACAAAGG + Intergenic
985688458 5:1294336-1294358 CCAGCTCGGCGCTGCCACTCAGG - Exonic
985782306 5:1877791-1877813 CAAGCCCGGCGCTGCCACGCCGG - Exonic
988609726 5:32712844-32712866 CCAGCCCGGCGCTGGCAAAGTGG - Intronic
997303428 5:132822841-132822863 CCAGCCCGGCGCGGCCCCCAGGG - Exonic
998393689 5:141804562-141804584 CCAGCCCAGTGCTGGTGCAAAGG + Intergenic
998446785 5:142204908-142204930 CCAGCCCGGTGCTCTCAGCAGGG + Intergenic
1000060684 5:157652418-157652440 CCCACCCGGAGCTGCGACAATGG + Exonic
1001437690 5:171713241-171713263 CCAGCCAGTTTCTGCCACACTGG - Intergenic
1001773326 5:174311669-174311691 CCAGCCCGGTGTAGCCAGCATGG + Intergenic
1002884093 6:1278561-1278583 CCAGCCCTGACCTGCCACAGTGG + Intergenic
1005317908 6:24621985-24622007 CAGGCCCAGTGCTGCCACCAGGG - Intronic
1005656700 6:27946070-27946092 CCATCCCAGTCCTGGCACAACGG - Intergenic
1006466263 6:34196605-34196627 GCATCCCGGTGCGGCCACAGAGG + Intergenic
1006876234 6:37299562-37299584 CCAGACAGGAGTTGCCACAAGGG - Intronic
1007262233 6:40571855-40571877 CCAGCCTGGTGCTGTCTCCATGG + Intronic
1013849238 6:114494056-114494078 CCCTCCCCGTGCCGCCACAAAGG - Intergenic
1018294339 6:162329446-162329468 CCAACCCGGTACTGCTGCAACGG - Intronic
1020143461 7:5624903-5624925 GCAGCCCGGTCCTCCCACCATGG - Intronic
1023841683 7:44101811-44101833 CCAGCCCAGTCCTGCCGCAGTGG + Intergenic
1025006756 7:55361703-55361725 TCAGTCAGGTGCGGCCACAATGG + Intergenic
1029152872 7:98493205-98493227 CCAGCCCGGTTCTGCATTAACGG + Intergenic
1033138298 7:138802920-138802942 GCAGCCCGGTGCTGCCGCACAGG + Exonic
1033348866 7:140545809-140545831 ACCGCCTGGTGCTGCCCCAACGG + Intronic
1034377991 7:150663795-150663817 CCAGGCTGGTGCTGACCCAAGGG - Intergenic
1037208145 8:16350381-16350403 CCAGCCCAGTGTTGCCTCCAAGG - Intronic
1037612514 8:20488257-20488279 CCAACCTAGTGCTGACACAATGG - Intergenic
1037987134 8:23297027-23297049 CCAGCCCAGTGTGGCCACCAGGG - Intergenic
1039455323 8:37702096-37702118 CCTGCCCTTTGCGGCCACAATGG - Intergenic
1044177790 8:89151434-89151456 CTAGCCCTGTGCTGTCAAAATGG - Intergenic
1045034266 8:98165198-98165220 CCAGCCAGTTGCTGCAGCAAGGG + Intergenic
1048403193 8:134091398-134091420 GCAGCACAGTTCTGCCACAATGG + Intergenic
1049113454 8:140664868-140664890 CCTGCCCAGTGCTGTCACAGAGG + Intronic
1050734138 9:8744099-8744121 CCACCTCGGTCCTGCAACAATGG + Intronic
1055667724 9:78569252-78569274 GCAGCCTGCTGCTGCCACAAGGG - Intergenic
1056575321 9:87851882-87851904 CCAGCCCCGTGCTGGCAACAGGG - Intergenic
1057081127 9:92175471-92175493 CCAGCCTGTGGCTGCCACAAAGG + Intergenic
1057212565 9:93208199-93208221 CCAGCACGGTGGTGTAACAAGGG - Intronic
1057438642 9:95065350-95065372 CCACCACGGTGCTGGCACCAGGG + Intronic
1058506282 9:105669500-105669522 CCAGCCTGGTGCTCCCAAATAGG - Intergenic
1061177289 9:129005392-129005414 GCAGCCCGCTGCTGACACAGAGG + Exonic
1061291181 9:129651128-129651150 CCAGCCCGGTGCTGGGACCTGGG - Intergenic
1061318219 9:129810931-129810953 CCAGCCCGGTGCTGCCACAAAGG - Exonic
1061377632 9:130235620-130235642 CCAGCCCAGAGCTGCCGGAAGGG + Exonic
1061856116 9:133442827-133442849 TCAGCCCGGCCCTGCCACATGGG - Intronic
1062110821 9:134781253-134781275 CCTGGCCGGTCCTCCCACAAGGG - Intronic
1062495749 9:136830808-136830830 CCAGGCTGGTGCTGCCAACAGGG - Intronic
1195566806 X:106348230-106348252 TCAGCCAGGTGTAGCCACAAAGG + Intergenic
1199612602 X:149631275-149631297 CGAGCCCCGTCCTGCCCCAAGGG - Intronic