ID: 1061319393

View in Genome Browser
Species Human (GRCh38)
Location 9:129818583-129818605
Sequence CTGGAGGAGTGGAAAGCAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 588}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061319393 Original CRISPR CTGGAGGAGTGGAAAGCAGA GGG (reversed) Exonic
900032183 1:380089-380111 CTGGATGAGAGCAAAGCAGCAGG + Intergenic
900052733 1:608275-608297 CTGGATGAGAGCAAAGCAGCAGG + Intergenic
900424159 1:2568457-2568479 GAGGAGGTGGGGAAAGCAGACGG - Intergenic
900552692 1:3264584-3264606 CAGGAGGAGCGGAAAGGGGAGGG + Intronic
901146093 1:7065539-7065561 CTGGAGGAGGGGACAGGAGATGG + Intronic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901436606 1:9250605-9250627 CTGCAGGGGTGGAGAGCAGCTGG - Intronic
901811053 1:11766907-11766929 CTCGAGGGGTGGGAAGCAGGGGG + Intronic
901849588 1:12007047-12007069 CTGCAGGTGTGGAAGGCAGTGGG + Exonic
901852772 1:12026542-12026564 CTGGAGGAGCCAGAAGCAGAGGG - Intronic
902158310 1:14508085-14508107 CAGGAGGATGGGAAAGCAGGTGG - Intergenic
902468286 1:16631228-16631250 GTGGAGGAGGTGAAATCAGAAGG - Intergenic
903297886 1:22356992-22357014 CTTGGGGAGTGGAAAGATGACGG - Intergenic
903318010 1:22524195-22524217 CTGGAGGAGAGGGAGACAGAAGG - Intronic
903559408 1:24216525-24216547 GGGCAGGAGGGGAAAGCAGAAGG - Intergenic
903917248 1:26773509-26773531 CTGGGGGAGTGGACAGGAGCTGG - Intronic
904303484 1:29571465-29571487 CTGGAGCAGTGGGAAGAAAATGG + Intergenic
904437069 1:30506009-30506031 CTGGAGGTGTGCACAGAAGATGG - Intergenic
904767483 1:32861644-32861666 CTGTAGGTTTTGAAAGCAGAGGG - Intergenic
904889101 1:33764506-33764528 CTTGAGGACTGGATAACAGAGGG + Intronic
905028725 1:34867620-34867642 CTCCAGGACTAGAAAGCAGAAGG + Exonic
905658009 1:39698501-39698523 CTGGAGGAGCAAAATGCAGATGG + Intronic
905658018 1:39698578-39698600 CTGGAGGAGCAAAATGCAGATGG + Intronic
906542288 1:46596527-46596549 CTGGGGAAGTAGAAAGCACAGGG + Intronic
907373567 1:54018193-54018215 CTGGAGGAGGGACAAGCAGGAGG + Intergenic
907463741 1:54621695-54621717 CTGGAGGGCTGGAGGGCAGAGGG + Intronic
908422161 1:63969656-63969678 ATGGAGGGGTGGAAAACACATGG - Intronic
908890815 1:68845261-68845283 CTGGAGGAGTTGAAAGTTGGAGG + Intergenic
909471474 1:76033706-76033728 CTGGAGGAGGGGGAGGCAGCAGG + Intergenic
909837603 1:80276598-80276620 ATGGAGAGGTGGAAAGGAGATGG - Intergenic
909953768 1:81752374-81752396 TTGGAGGTGTAGAAAGCAGAGGG + Intronic
910784525 1:90980816-90980838 CTGGAAGCGGGGAAAGCACAAGG + Intronic
910878611 1:91902200-91902222 ATGGAGGAGTGAAAAGAAGTAGG - Intronic
912368662 1:109155786-109155808 AGGGAGGAGTGGAAGGCAGCAGG - Intronic
913061858 1:115216133-115216155 TTGGGGGAGGGGAAAGCTGAGGG + Intergenic
914328992 1:146648609-146648631 CTGGGGGAGAGCAAACCAGAGGG - Intergenic
915011621 1:152692045-152692067 TTTGAGGAGTGGAGAGAAGAAGG + Intergenic
915106139 1:153536131-153536153 CAGGAGGCGTGGAAAGTCGAGGG - Exonic
915148012 1:153806802-153806824 CTGGAGGAGTGGGGAGAAAAGGG + Exonic
915185894 1:154104975-154104997 CTAGAGGAGAGGAGAGGAGAGGG + Intronic
915517381 1:156421260-156421282 GCGGAGGGGAGGAAAGCAGAGGG + Intronic
915554788 1:156655376-156655398 CTGGAGGAGAGGGAGCCAGAAGG + Intronic
916156662 1:161856493-161856515 CTTCAGATGTGGAAAGCAGAAGG - Intronic
916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG + Intronic
917531473 1:175839871-175839893 CTGGAAAAGAGGAAACCAGAGGG + Intergenic
917665297 1:177220204-177220226 ATGGGGGAGTGGAGAGCAGGAGG + Intronic
918006824 1:180548991-180549013 CAGGAGGAGTTGAAAGTGGATGG - Intergenic
918528056 1:185486584-185486606 CTGGAGAAGTGGAATGGAGCGGG + Intergenic
919367113 1:196675508-196675530 CTGGAGGAGAGGGAAACATAAGG + Intronic
919778006 1:201206596-201206618 CTGGAGGACTGGGGAGCAGCAGG + Exonic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
922602210 1:226865004-226865026 CTGGAGCAAGGGACAGCAGATGG + Intergenic
922770990 1:228182796-228182818 CTGGAGGTGTGGATAGCAGTTGG + Intergenic
923268857 1:232336768-232336790 GTGGAGGAGTGTAAAACAGATGG + Intergenic
923534495 1:234838314-234838336 CAGGGGGAGGGGAAAGAAGAAGG + Intergenic
923755217 1:236785660-236785682 CTGGAGGAGAGCAAGGCAGCAGG - Intergenic
924134477 1:240949369-240949391 GTGGATGAGTGGATAGCAGATGG - Intronic
924376882 1:243419939-243419961 CTGGAGGAATGAGAAGCAGGAGG - Intronic
924698788 1:246428880-246428902 CTGGAAGAGGGCAGAGCAGAGGG - Intronic
1063021095 10:2128223-2128245 ATGGATGAGTGAGAAGCAGATGG + Intergenic
1063331073 10:5159980-5160002 CTGGAGAAGTGCAAAGAAGCAGG - Intergenic
1063342683 10:5282873-5282895 CTGGAGAAGTGCAAAGAAGCAGG - Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1064198309 10:13263499-13263521 CTGGAGAAGCGGGCAGCAGAGGG - Intergenic
1064815732 10:19259707-19259729 CAGGAACAGGGGAAAGCAGATGG - Intronic
1065380828 10:25088248-25088270 CTGGAGGCAGGGAAACCAGAAGG + Intergenic
1065645621 10:27831048-27831070 CTGGAGGAGTGGATGGGGGAGGG + Intronic
1067812937 10:49444445-49444467 CTGGAGGAGGCAAAAGGAGATGG + Intergenic
1069345264 10:67462124-67462146 CTGGGGCAGTGGAAGCCAGAAGG - Intronic
1069373466 10:67770514-67770536 CTGAAGGGGTGGGAAGCAGAGGG + Intergenic
1069851710 10:71409576-71409598 ATTTGGGAGTGGAAAGCAGAGGG + Intronic
1069853036 10:71422902-71422924 CTGGGGGAGGGCAGAGCAGAGGG + Intronic
1069888035 10:71636203-71636225 CTGGAGTCATGGAAAGCAGTTGG + Intronic
1069898192 10:71691863-71691885 CTGGAGGCTTGGGGAGCAGATGG + Intronic
1070392038 10:75979705-75979727 GGGGAGGAGGGGAAATCAGAGGG - Intronic
1070535733 10:77375927-77375949 CGGGAGGAGGGGAAGGCAGCAGG - Intronic
1071545418 10:86525245-86525267 CTGGGGGAGTTGTAGGCAGAGGG - Intergenic
1071567785 10:86680608-86680630 GTGGGGAAGTGGAAACCAGAGGG - Intronic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1072195848 10:93116712-93116734 CTAGAGGAGTGGAACCAAGAGGG - Intergenic
1073172703 10:101525222-101525244 CTTGGGGAGTGTAAACCAGAAGG - Intronic
1073332338 10:102678760-102678782 CTGCAGGAGCCCAAAGCAGAAGG + Intronic
1073866067 10:107805313-107805335 TTGGCTGAGTGGAAAGGAGAGGG + Intergenic
1073917918 10:108427676-108427698 AAGGAGGAGTGAAAAGGAGAGGG + Intergenic
1074529143 10:114285080-114285102 GTGGTGCATTGGAAAGCAGATGG - Intronic
1074803461 10:117025660-117025682 CTTGAGGAGAGGAGAGGAGAGGG + Intronic
1074814267 10:117133050-117133072 CTGGAGGAGTGGGAAGCTGTCGG + Intronic
1074914483 10:117942178-117942200 CTGGAGGAGGAGAAAACTGAAGG - Intergenic
1075019878 10:118944021-118944043 CTGGAGGACCTGGAAGCAGAGGG + Intergenic
1075432395 10:122399013-122399035 ATGGAGGAGAGGAAAGCAGCTGG - Intronic
1075716068 10:124556137-124556159 CTGAAGAAGTGAAAGGCAGAGGG + Intronic
1076034243 10:127185674-127185696 TTAGAGAAGTGGAAAGGAGAAGG + Intronic
1076088610 10:127658825-127658847 CTGGAGCACGGGAAAACAGATGG - Intergenic
1076498585 10:130916205-130916227 CTGGAGCAGAGGAAACTAGAAGG + Intergenic
1076504108 10:130960612-130960634 ATGGAGGAGGGGTGAGCAGAGGG + Intergenic
1076600389 10:131653528-131653550 ATGGAGGCCTGGAAAGCAGAGGG + Intergenic
1077851120 11:6075209-6075231 ATTGAAGAGTGGAAAGGAGAAGG + Intergenic
1079272331 11:19000109-19000131 CTTGAGGAGAGGAGAGGAGAGGG - Intergenic
1080068816 11:28053751-28053773 CTGGGGTGGAGGAAAGCAGATGG + Intronic
1081781449 11:45715947-45715969 CAGGAGGCGTGGAAAGAAGATGG + Intergenic
1082007257 11:47426283-47426305 CTGGAGGAGCGGGCAGAAGATGG + Exonic
1082737608 11:56873936-56873958 CTGGAGGGGTGGAAGTCAGTGGG - Intergenic
1082848379 11:57744216-57744238 GTGGTGGACTGGACAGCAGAGGG - Exonic
1084026304 11:66452251-66452273 CTGGGGGACAGGGAAGCAGAGGG + Intronic
1084094338 11:66901100-66901122 CAGCAGGTGTGGAAAGCAGGGGG - Intronic
1084422383 11:69066801-69066823 CTGGAGGCTTGGTAGGCAGAGGG + Intronic
1084787196 11:71449098-71449120 CTGGAGGAGGGGGCAGCTGAAGG + Intronic
1085127265 11:74010374-74010396 GGGGAGGAGTGAGAAGCAGAAGG + Intergenic
1085462406 11:76702046-76702068 GTGGAGGAGTGGCAGGCAGGAGG + Intergenic
1085463702 11:76710307-76710329 GTGGAGGAGTGGGAAGAAGGGGG - Intergenic
1085618723 11:78021884-78021906 TTGGAGGAGTGGGGAGCAGCAGG - Intronic
1086160390 11:83715834-83715856 CCTGAAGAGTGGAAAGGAGAAGG - Intronic
1086966331 11:93031926-93031948 CTGCTGGAGTAGAAGGCAGATGG + Intergenic
1087080640 11:94168022-94168044 GTGGAGAAGTGGGAGGCAGATGG + Intronic
1088808486 11:113372984-113373006 TTGGAAGAGAGGAAAGGAGAAGG - Intronic
1089079456 11:115763718-115763740 CAGGAAGAGTGGAAAGAAGAGGG - Intergenic
1089439446 11:118502992-118503014 ATGGAGGTGTGGGAAGGAGAGGG - Exonic
1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG + Intergenic
1090853972 11:130596067-130596089 CAGGAGGAGTGAAAAGCATTGGG + Intergenic
1091173774 11:133541834-133541856 CTGGAGGGGTTGGAGGCAGAAGG - Intergenic
1091702768 12:2674692-2674714 CTGGAGGAGAGGCAGGCAGAGGG - Intronic
1091848615 12:3677577-3677599 CTGGAGAAGGGGGAAGGAGAAGG - Intronic
1091980884 12:4862833-4862855 CCGCATGAGTGGAAAACAGAGGG - Intergenic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1093966976 12:25338219-25338241 CTGAAGGAATGGAAAATAGATGG - Intergenic
1094028582 12:25985349-25985371 CAGGAGCTGTGGACAGCAGAGGG - Intronic
1094083734 12:26566019-26566041 AAGGAGGAGAGGAAAGGAGAAGG + Intronic
1094083757 12:26566133-26566155 GAGGAGGAGAGGAAAGGAGAAGG + Intronic
1094316744 12:29144538-29144560 TTGGAGGAGGGGAACCCAGAAGG - Intergenic
1095986201 12:48001440-48001462 CTGGAGCAGTGGAATGCAGGCGG + Intronic
1096031778 12:48423453-48423475 CTACAGGAGTGTAAACCAGATGG + Intergenic
1096563047 12:52450772-52450794 CTGGTGGGGTGCAAAGGAGAAGG - Intronic
1096565201 12:52472433-52472455 CTGGTGGGGTGCAAAGGAGAAGG - Intronic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097705103 12:62860170-62860192 AAGGAGGAGTGCAAAGCAAAGGG + Intronic
1098081514 12:66790929-66790951 CTGGAGGACTGGAAAGAAGATGG + Intronic
1098110265 12:67114074-67114096 ATAGAGGTATGGAAAGCAGAGGG - Intergenic
1098213959 12:68196085-68196107 TTGCAGGAGTGGGAAGAAGAGGG + Intergenic
1098881336 12:75920373-75920395 TTGGAGCAGTGGCAAGCAGATGG + Intergenic
1098883170 12:75937189-75937211 CTGGAGGAATGGAAAGCTATTGG + Intergenic
1098991210 12:77065967-77065989 CCAGAGGACAGGAAAGCAGATGG + Intergenic
1099648738 12:85396332-85396354 TTGGGGGACTGGAAAGTAGATGG - Intergenic
1100084450 12:90892057-90892079 TTGGAGGAGTGAAAGGGAGAGGG - Intergenic
1100291194 12:93216367-93216389 CTGGAGGAATAGAAAACACATGG - Intergenic
1100408653 12:94293571-94293593 CTTGTGTAGTGGAAAGCAGAGGG + Intronic
1100737984 12:97559204-97559226 CAGTAGGAGTGGAAATCAAAAGG - Intergenic
1101098304 12:101366606-101366628 CTGGAGTTGGGGGAAGCAGAAGG - Exonic
1101219946 12:102628200-102628222 ATAGAGGAGTGAAATGCAGAGGG - Intergenic
1101459181 12:104872353-104872375 TTGGAGGAGTGGAGAGGAAAAGG + Intronic
1102663253 12:114547814-114547836 TGGGAGGGTTGGAAAGCAGAAGG - Intergenic
1102852014 12:116256423-116256445 CTGGAGGGGAGGAAGGCTGAGGG + Intronic
1103402151 12:120650361-120650383 CTTAAGGAGATGAAAGCAGAAGG - Intronic
1103562487 12:121799957-121799979 CTGGAGGAGAGGAAGGTGGAGGG + Intronic
1104302194 12:127574542-127574564 CTGGATGTTTGGAAAGGAGATGG - Intergenic
1104520972 12:129474703-129474725 CTGGGGGAGTGCAAAGGTGAGGG + Intronic
1104908468 12:132228192-132228214 CTGCATGAGTGGAGGGCAGAGGG - Intronic
1104960227 12:132485068-132485090 AAGCAGGAGTGGAATGCAGAAGG - Intergenic
1105886646 13:24648594-24648616 GTGGAGGAATGGAAAAGAGAGGG - Intergenic
1106119501 13:26847824-26847846 ATGGTGGAGTGGAAAGCACTGGG - Intergenic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107146518 13:37066447-37066469 TTGGAAGTGTGGAAAGCAGCTGG - Intergenic
1108450520 13:50558187-50558209 CTATAGGAGTTGAGAGCAGAGGG + Intronic
1108973067 13:56401666-56401688 CTAGAGCAGTGGTAAGCATAGGG + Intergenic
1109097530 13:58136814-58136836 ATGGAGAAGTGGTAAGCAGAGGG + Intergenic
1109150045 13:58835742-58835764 CTGGAGGAGTGGGGAGCAGAGGG - Intergenic
1109718371 13:66246199-66246221 CTGCAGGAGTGGAGCACAGATGG + Intergenic
1110376684 13:74802402-74802424 CTTGAGGAGAGGAGAGGAGAGGG + Intergenic
1110533764 13:76627472-76627494 CAGCAGGAGTGGCAAGAAGATGG + Intergenic
1111764567 13:92511919-92511941 CTGGAGAAGTGGGAGGCAAATGG + Intronic
1111770709 13:92592395-92592417 ATGGAAGAGAGGAAAGCAGGAGG - Intronic
1113316553 13:109186293-109186315 CAGGAGGAGAGGAAAGCATTAGG + Intronic
1113346809 13:109486190-109486212 CAGGAGGAATAGAAAGCAGGGGG - Intergenic
1113555620 13:111231727-111231749 TGGGAGGAGAGGAGAGCAGAAGG + Intronic
1113827240 13:113265839-113265861 CTGTAAAAGTGGAAAGGAGAAGG + Intronic
1114332564 14:21652140-21652162 CTGGGAGAGGGGAAAGGAGAGGG + Intergenic
1114598347 14:23933637-23933659 CAGCAGGGGTGGAAAGGAGATGG - Intergenic
1115002881 14:28442751-28442773 GTGGGAGAGTGAAAAGCAGAGGG + Intergenic
1115172684 14:30527470-30527492 CTGGTGGAGTGTAAGGGAGATGG - Intergenic
1115542629 14:34437018-34437040 CTGGAGGAGTAAGAATCAGATGG - Intronic
1117264985 14:54077206-54077228 CTTGAGGAGAGGAGAGGAGAGGG - Intergenic
1117491036 14:56248564-56248586 ATGGAGGGTTGGGAAGCAGAAGG + Intronic
1118572493 14:67207571-67207593 CAGGGGCAGTGGAAAGAAGAAGG + Intronic
1118808329 14:69256646-69256668 GTGGAGGAGTGGATAACCGAGGG - Intergenic
1119543610 14:75456525-75456547 CTGGAGCAGGGGAAAGCAGGTGG - Intronic
1119713939 14:76844912-76844934 CTGGAGGAAGGGACAGCAAAGGG + Intronic
1120249427 14:82044370-82044392 CTTGAGGATTGCAAACCAGAAGG + Intergenic
1120861005 14:89254880-89254902 GTGGGGGAGTGGACAACAGAAGG - Intronic
1120979556 14:90278325-90278347 CTGGAGGATTAGAGAGCAGCGGG - Exonic
1121078364 14:91088008-91088030 CTTGGGGAGGTGAAAGCAGAGGG + Intronic
1122357755 14:101134180-101134202 CTGGAAGCGTGGAAGGCACAAGG + Intergenic
1122371556 14:101231798-101231820 CAGGAGGAGGGGAAGGCATAGGG - Intergenic
1123694851 15:22871502-22871524 ATGGAGGAGTGGGAGGCAGAAGG + Intronic
1124027053 15:25976574-25976596 CTGGAGGAGCGGCCAGCAGTGGG - Intergenic
1124593997 15:31078687-31078709 CTGGAGAAGTGCGAAACAGACGG - Intronic
1127692242 15:61408781-61408803 CTGGAGGAGTATAAAGGAGTTGG - Intergenic
1128515025 15:68336627-68336649 CAGCAGGTGTGGAAAGCCGATGG + Intronic
1128548343 15:68582011-68582033 GTGGAGAAGAGGAAAGCAGATGG + Intronic
1129940801 15:79495252-79495274 CTGGGGAAGTGGGAAGCAGGGGG + Intergenic
1130198956 15:81807611-81807633 CTGGTGGAGTGGCACGTAGAAGG + Intergenic
1130771317 15:86926752-86926774 CTGGAGGATTGGATACCACAGGG + Intronic
1130925337 15:88381449-88381471 GTTGAGGAGTGGGAAGGAGATGG - Intergenic
1131143962 15:90000159-90000181 CCGGAGGAGTGGGGAGAAGACGG - Intergenic
1131232605 15:90670579-90670601 CTGGAGGGGTGGGGAGCAGGGGG + Intergenic
1131337746 15:91565975-91565997 TTGCAGGAGTGTAAAGCAGCTGG - Intergenic
1131669160 15:94600739-94600761 CTGGAGGAGGGGGAAGGAGAAGG - Intergenic
1132101155 15:99024419-99024441 CAGGGAGGGTGGAAAGCAGAGGG - Intergenic
1132193640 15:99892415-99892437 ATGGAAGAGAGGAAAGCAGGAGG + Intergenic
1132832026 16:1933105-1933127 CTGGGGGAGGGGCAAGCAGCAGG + Intergenic
1133835357 16:9362804-9362826 GTGCAGGAGAGGAAAGCATAAGG - Intergenic
1135007344 16:18838141-18838163 CTGGTGGACTGGACAGCAGGAGG - Exonic
1135181837 16:20281576-20281598 CTGGAGGAGAGGAAGCCTGAGGG + Intergenic
1135525281 16:23209400-23209422 CTGGAGGCGTTAAGAGCAGATGG - Intronic
1136080815 16:27851579-27851601 GTTGAGGAGCGGCAAGCAGAGGG + Intronic
1136459980 16:30404182-30404204 ATGGAGGAGAGGTAGGCAGAGGG - Intergenic
1137483408 16:48871332-48871354 CTGGAGAAGAGGAAAGAGGAAGG + Intergenic
1137568533 16:49549509-49549531 CTGGAGGAGAGGAGAGGAAATGG - Intronic
1137646543 16:50080058-50080080 CTGGAGGAAGGGAGAGCACAGGG + Intronic
1138229680 16:55327827-55327849 GGGGAGGAGAGGAAGGCAGAGGG + Exonic
1138240900 16:55426246-55426268 CTGGAGGAGGGCAGAACAGAGGG + Intronic
1138249487 16:55491051-55491073 AAGGAGGAGAGGCAAGCAGAGGG - Intronic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1138717451 16:59040198-59040220 CTGGTATAGTGGAAAGAAGACGG - Intergenic
1138993585 16:62421250-62421272 ATCTAGGAGTGGAAAGCAGCAGG + Intergenic
1139298329 16:65922334-65922356 GTGGAGCAGTGGAGAGGAGAGGG - Intergenic
1140004574 16:71062334-71062356 CTGGGGGAGAGAAAACCAGAGGG + Intronic
1140727000 16:77822529-77822551 TTGGAGGAGGGGAGAGAAGAAGG + Intronic
1140985950 16:80158099-80158121 CTGGAGCACAGGGAAGCAGAGGG - Intergenic
1141131726 16:81442135-81442157 CCAGAGGAGTGGGAAGCACATGG + Intergenic
1141265272 16:82490939-82490961 AAGGAGGAGTGGACAGCAGTAGG + Intergenic
1141316740 16:82969519-82969541 CTGGAAGAGTGGAAAGATGATGG + Intronic
1141662014 16:85446570-85446592 CAGCAGGAGTGGAGAGCAGAGGG + Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1142756520 17:2019524-2019546 GTGGTGGAGTTGAAAGCAGATGG - Intronic
1143311692 17:5997323-5997345 CTGGAGGAATGTAAAGCATGTGG - Intronic
1143724218 17:8834302-8834324 CTGGAGCAGAGGAAATGAGAGGG + Intronic
1143734040 17:8897834-8897856 ATGGTGGAGTGGAAAGATGAGGG + Intronic
1143858299 17:9869200-9869222 CTGGAGGAGGGGAGATCAGTTGG - Intronic
1144252394 17:13430831-13430853 CTGGTGTGGTGGAAAGAAGAAGG - Intergenic
1144436898 17:15250360-15250382 GGGGAGGAGTTGAGAGCAGAAGG - Intronic
1144772843 17:17769470-17769492 CTGGAGGAGCAGAAAGTAGTAGG + Intronic
1145029383 17:19493111-19493133 CTGGAGCAAGGGAAAACAGATGG + Intergenic
1145039534 17:19567116-19567138 GAGGGGGAGTGGAAATCAGAAGG + Exonic
1145825969 17:27877602-27877624 TTGGAGTAGTGGAAGTCAGAGGG + Intronic
1146604392 17:34245948-34245970 AGGGAAGAGTGGAAAGAAGATGG + Intergenic
1146833528 17:36090602-36090624 CTGGAGGAATAGAAAGCATGAGG + Intergenic
1146848112 17:36197527-36197549 CTGGAGGAATAGAAAGCATGAGG + Intronic
1147203840 17:38822729-38822751 CTGGAGATGTGGCAAGCTGATGG + Intronic
1147635499 17:41961507-41961529 CTAGAGGAAAAGAAAGCAGAGGG - Intronic
1148353104 17:46955673-46955695 CTGGAGGAGGTGAGTGCAGAAGG - Intronic
1148556062 17:48579129-48579151 AGGGAGGAGTGGATAGGAGAAGG - Exonic
1149389500 17:56174791-56174813 CTGGGGGAGGGGAAAGATGAAGG - Intronic
1149541585 17:57471863-57471885 CTGGAGGAGAGGAGAGGAGAGGG + Intronic
1150125554 17:62632411-62632433 CAGGAGGAGTGGGAGGCTGAGGG - Intronic
1151175485 17:72284480-72284502 ATAGAGGAGTGGAAGGCACAGGG + Intergenic
1151378560 17:73708769-73708791 ATGGTGGAGTGCACAGCAGAGGG - Intergenic
1151425715 17:74029851-74029873 CTGTGGGGGTGGAAAGCAGCTGG + Intergenic
1152603057 17:81274807-81274829 CTGTAGGAGTTGAAACCAGAGGG - Intronic
1152976691 18:228066-228088 CTGGAGGAAGGGAAGGCTGATGG - Intronic
1153063137 18:1014455-1014477 ATGGAGCAGTGAGAAGCAGAGGG + Intergenic
1153819072 18:8817332-8817354 GTGGAGGAGGAGAGAGCAGAGGG + Intronic
1156013218 18:32517759-32517781 CTGGGAGAGGGGAAAGGAGAAGG - Intergenic
1156358711 18:36364887-36364909 CTGAAGGGGGAGAAAGCAGAAGG + Intronic
1156373526 18:36492112-36492134 GTGGAGGACTGGAAAGAACACGG - Intronic
1156384792 18:36595283-36595305 ATGGAGGAGAGGAAGGGAGAAGG - Intronic
1156468318 18:37361976-37361998 CTGCTGGAGTGGGAAGCGGACGG + Intronic
1156489401 18:37487376-37487398 TTGGAGGTGGGGAAGGCAGAGGG - Intronic
1156909132 18:42389953-42389975 TTGGCTGTGTGGAAAGCAGATGG - Intergenic
1157316520 18:46594387-46594409 CTGGATGAGAAGAAAGCGGATGG - Intronic
1157391563 18:47307544-47307566 CTGGAGGGGCTGACAGCAGAGGG + Intergenic
1157502401 18:48200801-48200823 CTGGCGGAGCAGAAAGTAGATGG + Intronic
1157830616 18:50854002-50854024 GGGGAGGAGAGGAAACCAGAAGG + Intergenic
1158293969 18:55973239-55973261 CTGGAGGATAGGAAAGTAGGGGG - Intergenic
1159548675 18:69872109-69872131 CTGAAGGAGAGGAGTGCAGATGG + Intronic
1159926177 18:74271032-74271054 CTGGAGGAGTTGGAATGAGAGGG - Intronic
1160937918 19:1606046-1606068 CTGGTGCGGTGGAAAGCAGGAGG - Intergenic
1162576293 19:11500943-11500965 TTGGAGAAGTGGACAGGAGAGGG - Intronic
1163402410 19:17102042-17102064 CTGCAGGAGCGCAACGCAGATGG + Exonic
1163551374 19:17967792-17967814 CTGGAGGGCTGGCCAGCAGATGG + Intronic
1165108307 19:33487216-33487238 CTGGGTGAGTGGAAGGCAGGGGG + Intronic
1165132666 19:33642272-33642294 GTGGATGAGTGGGCAGCAGAGGG + Intronic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1167223429 19:48219121-48219143 CTGGTTGAGTGGGAAACAGAGGG + Intronic
1167902866 19:52635257-52635279 CTGGTGCAGTGGGCAGCAGAGGG - Exonic
1167922515 19:52793514-52793536 CTGGAGCAGTGGAAGAGAGAAGG + Intronic
1167932074 19:52874173-52874195 CTGGTGTAGTGGGCAGCAGAGGG - Intronic
1167933812 19:52890431-52890453 CTGGGGCAGTGGGCAGCAGAGGG - Intronic
1168001163 19:53447071-53447093 CTGGTGCAGTGGGCAGCAGACGG + Intronic
1168024234 19:53632171-53632193 GTGAAGAAGTGGAAAGCAGCTGG + Intronic
1168326400 19:55540898-55540920 CTGGAGGAGTGGACAGATGAGGG - Exonic
925336011 2:3099806-3099828 CTGGTGGAGTGGGGAGCAGGTGG - Intergenic
925783200 2:7402914-7402936 CTGGAGTAGAGGGGAGCAGAAGG + Intergenic
925882367 2:8363505-8363527 ATGGAGAAGAGGAAAACAGAAGG + Intergenic
926205719 2:10833291-10833313 CCGGAGGAGGGGAGAGGAGAGGG - Intronic
926634034 2:15161973-15161995 CTGGAGGAGAGGAACACTGAGGG - Intergenic
926772673 2:16392368-16392390 ATGGACAAGGGGAAAGCAGAGGG + Intergenic
927003223 2:18821475-18821497 TTGGAGGAGAAGAAAGCTGATGG + Intergenic
927091374 2:19715257-19715279 CTGTAAGAGTTTAAAGCAGATGG + Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
928047993 2:27957721-27957743 CTGGAGGAGTGGTAAGGTCATGG - Intronic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
928615435 2:33034001-33034023 CTGGGGGACAGGAGAGCAGATGG + Intronic
928933133 2:36645907-36645929 CTGGAGAAGTGAAAGGGAGAAGG + Intronic
929884072 2:45863015-45863037 CTGGAGGAGAAGAGAGCAGTTGG + Intronic
930511389 2:52349727-52349749 GTGGAGGAGAGGAAGGAAGAAGG - Intergenic
931601578 2:64008676-64008698 GAGGAGGAGTGGAAATCAGCTGG + Intronic
931686725 2:64800326-64800348 CTGGAGGAGTCAAAGGCTGAAGG - Intergenic
931774432 2:65528250-65528272 CTGCAGGAATGGAAAGGAAAGGG + Intergenic
931994180 2:67824015-67824037 CTAGAGGAGTGGAGAGGAGAGGG - Intergenic
932211571 2:69935849-69935871 CAGGAAGCATGGAAAGCAGACGG - Intronic
932442815 2:71748536-71748558 CGGGAAGGCTGGAAAGCAGAGGG - Intergenic
932562239 2:72883462-72883484 TTGGCAGAGAGGAAAGCAGAGGG + Intergenic
932839848 2:75072039-75072061 CTGGAGGAGTGGCAGCCAGGAGG + Intronic
933997495 2:87680423-87680445 CTGGAGGAGAGGAAGGCACATGG + Intergenic
934032130 2:88057536-88057558 CTGGAGCAGTTGAAGTCAGAGGG - Intergenic
936296357 2:111270489-111270511 CTGGAGGAGAGGAAGGCACATGG - Intergenic
936749340 2:115622169-115622191 CATGAGGGGTGGACAGCAGAGGG - Intronic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
937315970 2:120932334-120932356 CTTGAGCAGTGGAAAGCAGGAGG - Intronic
937457372 2:122054223-122054245 CTAGAGGAGGCGAAAGGAGAAGG - Intergenic
938131590 2:128720238-128720260 TTGGGGGACTGGAAAGCAGATGG + Intergenic
938386368 2:130870096-130870118 CTGCAGGGGTTGACAGCAGAGGG - Intronic
938642038 2:133291431-133291453 CGGGAGGAAAGGAGAGCAGAGGG + Intronic
939763637 2:146217178-146217200 ATGGAGGAGTGGACAGGAAAAGG + Intergenic
940029333 2:149244301-149244323 AGGGAGGAGGGAAAAGCAGAAGG - Intergenic
940133704 2:150412578-150412600 CTGGAGTAGTTGAAAGGACATGG - Intergenic
940606447 2:155929420-155929442 TTGGTGGTGTGGTAAGCAGATGG + Intergenic
943045349 2:182854578-182854600 CTGGAGGAATGGAATGCAAGAGG - Intronic
943214214 2:185009823-185009845 ATGGAGGTGTGGAAAGAGGAAGG - Intergenic
943422928 2:187691190-187691212 CTGGAAGATTTTAAAGCAGAGGG - Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
945060565 2:205905133-205905155 CTGTAGTAATAGAAAGCAGATGG - Intergenic
945062934 2:205924568-205924590 CTGGAGGCAAGGAAAGCAGGTGG + Intergenic
945306728 2:208266210-208266232 CTGGGGGACAGGAAAACAGAGGG + Intergenic
946022868 2:216653637-216653659 CTGGAGATGAGGAAGGCAGATGG - Intronic
946077648 2:217088260-217088282 CATGAGGAGATGAAAGCAGATGG - Intergenic
946372586 2:219289978-219290000 CAGGAGGAGAGGAAAGGACATGG - Exonic
946573664 2:221051244-221051266 TTGGAGGAGAGGGAAGAAGAAGG + Intergenic
946852216 2:223918788-223918810 ATGGAGGAGTGGCATGGAGAGGG + Intronic
947251797 2:228114981-228115003 CTGGAGGAGGGGATGGCAAAGGG + Intronic
947443838 2:230148089-230148111 CTGGAAGACTGGAAGGCTGAGGG + Intergenic
1169028713 20:2391516-2391538 CTGGAGGAGTGGAAAGCAATGGG + Intronic
1169275174 20:4228877-4228899 CTGGAGACGTGGAGAGAAGAAGG - Intronic
1169541085 20:6600489-6600511 GAGGAGGAGAGAAAAGCAGAAGG + Intergenic
1169874186 20:10278865-10278887 CTGGAGGAGTGGGAAGGAGGTGG + Intronic
1170179248 20:13510981-13511003 GTGGGTGGGTGGAAAGCAGAAGG - Intronic
1170589179 20:17758309-17758331 CTGGAGGAGCGGACAGCAGTTGG + Intergenic
1170716988 20:18840384-18840406 CTGGAGGAGAGGAATGGAGTGGG - Intergenic
1170880351 20:20291687-20291709 CTGGAGGGGAGGAAAACAGTGGG - Intronic
1171139497 20:22728823-22728845 ATGGAGGACTGGAAAGAGGAGGG + Intergenic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1172621257 20:36319960-36319982 CCGGGGGAGTGGGACGCAGAGGG - Intronic
1172621268 20:36319987-36320009 CTGGAGGAGAGGGACACAGAGGG - Intronic
1172621286 20:36320041-36320063 CTGGAGGAGAGGGACACAGAGGG - Intronic
1172621340 20:36320203-36320225 CTGGAGGAGGGGGACACAGAGGG - Intronic
1172683692 20:36737265-36737287 CTTCAGGAGTGGAAGGCAGGGGG - Intronic
1172842417 20:37909888-37909910 CTGGAGCAGTGGGAACCAGGGGG - Intronic
1172901518 20:38338290-38338312 CTGGAGGAGTTCGATGCAGACGG + Intergenic
1173558471 20:43984834-43984856 CTGGGGGAGGGGATAGCAGTGGG + Intronic
1173725330 20:45293396-45293418 CTGGGGGAGGGGAAGCCAGACGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174932874 20:54834451-54834473 CTGGAGAAGGGGAAAGGAGGAGG + Intergenic
1175226135 20:57444999-57445021 CAGGAGGTGTGGGAAGCAGGAGG + Intergenic
1175772352 20:61631800-61631822 CTGAAGGTGTGGACAGCAGTGGG + Intronic
1176002560 20:62839598-62839620 GTGGAGGAGAGGAGAGGAGAAGG - Intronic
1176520195 21:7818475-7818497 AGGGAGGAGTGGAAGGCGGAAGG + Exonic
1176695436 21:9971999-9972021 CTTGAGGAGTTGAGAGCAGTGGG - Intergenic
1176870326 21:14078797-14078819 ATGAAGGAGTGGGAAACAGAGGG + Intergenic
1177214892 21:18115467-18115489 ATGGAGGTGTGGAAAAAAGAAGG - Intronic
1177281498 21:18987696-18987718 GTGGAGGGGTGGAATGCAGCAGG + Intergenic
1177837068 21:26196445-26196467 CTGGGGGAGAGAGAAGCAGAGGG - Intergenic
1178147816 21:29759794-29759816 AGGGAGGAGTAGACAGCAGAGGG - Intronic
1178654221 21:34448487-34448509 AGGGAGGAGTGGAAGGCGGAAGG + Intergenic
1178683044 21:34689239-34689261 CTGGAGGTGTGGAAAACCAAAGG - Intronic
1179144768 21:38758170-38758192 CAGGAGGAAAGGACAGCAGAGGG - Intergenic
1179144878 21:38759219-38759241 CAGGAGGAAAGGACAGCAGAGGG - Intergenic
1180163367 21:46007701-46007723 TGGGAGGAGTGGGAAGGAGAGGG - Intergenic
1181416356 22:22762257-22762279 CTGCAGGAGAGGAAAGGAGAGGG - Intronic
1181552088 22:23645692-23645714 CTTGGGGAGGGGAAAGCAGGTGG - Intergenic
1182153501 22:28047983-28048005 TTTGAGGAGTGGAAAGGAGCAGG - Intronic
1182422939 22:30257411-30257433 CAGCAGGAGAGGGAAGCAGAGGG - Intergenic
1183204311 22:36408089-36408111 GTGGAGGAGGGGAGAGGAGATGG - Intergenic
1183367070 22:37412552-37412574 CTGGAGGAGTGCCAGGAAGAAGG - Intronic
1184002004 22:41681943-41681965 CTGGAGCAGTGGGAATGAGATGG - Intronic
1184648953 22:45910919-45910941 CTGGAGCAGGGGACAGAAGAGGG - Intergenic
1184829809 22:46977456-46977478 CAGGGGGAGTGGACAGCTGATGG + Intronic
1185020563 22:48372346-48372368 CTGGATGGGTGCAAAACAGAGGG - Intergenic
1185290136 22:50020280-50020302 ATGGAGGAGTGCACATCAGATGG - Intronic
1185290210 22:50021035-50021057 ATGGAGGAGTGCACATCAGATGG - Intronic
1185290222 22:50021155-50021177 ATGGAGGAGTGCACATCAGATGG - Intronic
1185290234 22:50021275-50021297 ATGGAGGAGTGCACATCAGATGG - Intronic
1185290238 22:50021316-50021338 ATGGAGGAGTGCACATCAGATGG - Intronic
1185290240 22:50021335-50021357 ATGGAGGAGTGCATATCAGATGG - Intronic
1185290246 22:50021395-50021417 ATGGAGGAGTGCACATCAGATGG - Intronic
1185290260 22:50021537-50021559 ATGGAGGAGTGCACATCAGATGG - Intronic
1185290264 22:50021578-50021600 ATGGAGGAGTGCACATCAGATGG - Intronic
1185290280 22:50021742-50021764 ATGGAGGAGTGCACATCAGATGG - Intronic
1185290290 22:50021843-50021865 ATGGAGGAGTGCATATCAGATGG - Intronic
1185290328 22:50022256-50022278 ATGGAGGAGTGCACATCAGACGG - Intronic
950181298 3:10915304-10915326 CTGCTGGAGGGGGAAGCAGAAGG - Intronic
951180645 3:19654742-19654764 CTGGTGGAGTGGTGAGAAGAGGG - Intergenic
952716482 3:36485321-36485343 ATGGTGGAGTGGAAAGAACACGG + Intronic
953254377 3:41275513-41275535 CTGCAGGAGTGTCTAGCAGAGGG + Intronic
953355379 3:42251876-42251898 CTAGAGGTGTGCACAGCAGATGG + Intergenic
954266219 3:49472169-49472191 CTGGTGGAGTGGCAGGAAGAGGG + Intronic
954672556 3:52298700-52298722 CAGCAGGAGTGGGAGGCAGAGGG - Intergenic
955607356 3:60720112-60720134 CTGGAGCAGAGGAAACCAGGTGG - Intronic
956192434 3:66620654-66620676 GTGGATGAGTGGCAGGCAGATGG - Intergenic
956734425 3:72227056-72227078 CTGGAAGAGTGGCAAGAAAAGGG + Intergenic
957160847 3:76608050-76608072 ATGGAGGATTTGTAAGCAGAGGG - Intronic
957725294 3:84057266-84057288 GAGGAGGAGTGGAAAAGAGAGGG + Intergenic
959808033 3:110581595-110581617 CTGGAGGAGTGGAGGGGACAGGG - Intergenic
960352280 3:116607773-116607795 CTGGAGAAGTTGAGAGCAGTGGG + Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961566629 3:127768715-127768737 CTGGAGGGGTGGACAGGACAGGG - Intronic
961976543 3:131030913-131030935 CAGGAGGAACAGAAAGCAGAAGG + Intronic
962389923 3:134962780-134962802 CAGGAGGAGGGGAGGGCAGAGGG - Intronic
962471246 3:135711202-135711224 CTGGAGGAAGGGAGAGCTGAGGG - Intergenic
962847274 3:139283584-139283606 CTGGTGGAGTGGACAGGAGCTGG + Intronic
964131409 3:153291900-153291922 CTGGAACAGAGGAAAGCAGCAGG - Intergenic
965467758 3:169053558-169053580 ATCCAGGAGTGGAAAGCAGAGGG - Intergenic
965950881 3:174306688-174306710 CTGGAGGCTAGAAAAGCAGAAGG + Intergenic
967983070 3:195077200-195077222 CTGGGGAAGGGAAAAGCAGAGGG + Intronic
968447811 4:661174-661196 ATGGATGGGTGGACAGCAGATGG + Intronic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
970683143 4:18534656-18534678 CTGGAGGCCAGGAAAGCTGATGG - Intergenic
970959594 4:21856900-21856922 CTGGAGGAGTCCAAGGCAGCAGG - Intronic
970976752 4:22050500-22050522 GTGGAGGGGTGGAGGGCAGAGGG + Intergenic
972252326 4:37316313-37316335 CAGAAGGAGTGGAAGCCAGAAGG - Intronic
972333571 4:38085509-38085531 CTGGGGGACTGGAACCCAGAAGG + Intronic
974487003 4:62518318-62518340 CTGGAGAAGTGAGAAGCTGAAGG + Intergenic
974691530 4:65303622-65303644 CTGGAGCAGTGGCATGCTGATGG + Intergenic
975225658 4:71868659-71868681 TTGCAGTTGTGGAAAGCAGAAGG + Intergenic
975237766 4:72020319-72020341 CTGGAGGAGGAGCAAGCATAGGG - Intergenic
975411286 4:74054197-74054219 CTGGAGGAAATGAATGCAGATGG + Intergenic
975526153 4:75352708-75352730 TTGGAGTGGTGGAAATCAGAAGG + Intergenic
975784053 4:77868701-77868723 CTAGTGGAGTGGAAAGCAATAGG + Intronic
975986105 4:80202657-80202679 CAGGAGGAGGGGACAGCCGACGG + Exonic
976351445 4:84064530-84064552 CTGGAGAGGTGGACAGCAGCAGG + Intergenic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978074227 4:104509048-104509070 CTGGAGGCCAGGAAAGCTGATGG - Intergenic
978452869 4:108855139-108855161 GTGGAACAGTGGAAAACAGAAGG - Intronic
978816092 4:112907484-112907506 GAGGAGGAGGGGAAAGAAGAGGG - Intronic
978940941 4:114435137-114435159 CTGTAGGAGAGGCCAGCAGATGG + Intergenic
979544807 4:121927883-121927905 TTTCAGGAATGGAAAGCAGATGG - Intronic
980368062 4:131832248-131832270 CTCGAGGAGTTGAGAGCAGTGGG - Intergenic
981117608 4:141010448-141010470 CTGGAGGACTGCAAAGTGGATGG - Intronic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
982737754 4:159023829-159023851 CTGGAGGAGCGGAGACCTGAGGG - Intronic
983022198 4:162691641-162691663 GAGGAGGAGTAGAAAGCACATGG + Intergenic
983339367 4:166438613-166438635 CTAGAGGAGAGGAAAGAAGAAGG - Intergenic
984592964 4:181636936-181636958 CTGGAGTGGTGTAAACCAGAGGG - Intergenic
985013084 4:185604460-185604482 ATGGAGGGGAGGAAAGCAGGTGG + Intronic
985918349 5:2945719-2945741 CTGAAGGACGGGAAAGCAGTGGG + Intergenic
985932258 5:3067796-3067818 GGGGAGGAGTGACAAGCAGAAGG - Intergenic
986081102 5:4394991-4395013 CTAGGGGAGTGGAGTGCAGAAGG - Intergenic
986324959 5:6665443-6665465 CTGGCGGAGGAGAAAACAGAGGG - Intronic
986502439 5:8414982-8415004 AAGGAGGAATGGAAGGCAGAAGG - Intergenic
986868622 5:12019788-12019810 CTGTAGGAGGTGGAAGCAGAGGG - Intergenic
987218159 5:15761180-15761202 CTGAAGCAGTGGAAAGGAAATGG - Intronic
988522684 5:31960512-31960534 ATGGAGGAGTAGAAAGCATCTGG - Intronic
988617888 5:32793116-32793138 CTTGAGGAGTGGAGAGGAGGAGG + Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
990137996 5:52670486-52670508 CTGCAGCAGTGGAATACAGAGGG + Intergenic
992213818 5:74506514-74506536 GTGCTGGAGTGGAAAGAAGAAGG - Intergenic
993042216 5:82827089-82827111 CTGGAGGAGAGGAGAACAGGAGG + Intergenic
993042767 5:82834453-82834475 CTGAGGTATTGGAAAGCAGAGGG + Intergenic
993180084 5:84541445-84541467 GTGAAGGAGAGGAAAGCACATGG - Intergenic
994223800 5:97228633-97228655 ATGGAGGAGAGGACAGGAGAGGG + Intergenic
994845844 5:104987410-104987432 CTTGAGGAGAGGAGAGGAGAGGG - Intergenic
995738063 5:115324749-115324771 ATGGAGGAGTGGAAAGGATCTGG - Intergenic
995833266 5:116376654-116376676 CTGGAGCAGTGGGAAGCACAAGG - Intronic
996040163 5:118800400-118800422 TTGGAGGAGGGGAAACCTGAGGG + Intergenic
997835455 5:137188601-137188623 CCTGAGGAGAGGAAAACAGATGG - Intronic
998049876 5:139023390-139023412 CTGGAGGAAAGGAAAGAAGCAGG + Intronic
998698091 5:144664032-144664054 CTTGAGTAGTACAAAGCAGAGGG + Intergenic
999126453 5:149249792-149249814 CTGCAGGAGAGAAAAGCTGAAGG - Intronic
999215675 5:149932935-149932957 CCGGCGGAGTGGCCAGCAGAGGG + Intronic
999970779 5:156860102-156860124 CAGACTGAGTGGAAAGCAGATGG + Intergenic
1000109681 5:158095943-158095965 GTGGGGGAGTGGAAAGAAGATGG + Intergenic
1001093251 5:168756944-168756966 CTGGGAGAATGGAAAACAGAAGG + Intronic
1001112581 5:168909719-168909741 CTAGCGGAGAGGAAAGCAGGAGG - Intronic
1001276522 5:170355321-170355343 CTGGAGAAGGAGAAAGCAAAGGG + Intronic
1001785714 5:174411220-174411242 CTGGAGGAGTTGTAATCAGCTGG - Intergenic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002599588 5:180346622-180346644 CTGCAGGAGTGGGACCCAGAGGG - Intronic
1002741637 5:181438779-181438801 CTGGATGAGAGCAAAGCAGCAGG - Intergenic
1003122978 6:3333412-3333434 CGGGAGGGGTGGAAATCACATGG - Intronic
1003197311 6:3926251-3926273 CAGGAGGAGGAGAAAGCAGGAGG + Intergenic
1003286241 6:4736055-4736077 CTGGGGGAGTGGGAAACAGGAGG - Intronic
1003318507 6:5032898-5032920 CAGGAGGAGGAGAAAGCAGGAGG - Intergenic
1003332602 6:5142399-5142421 CTGGAAGATTGGAAAGCTGGGGG - Intronic
1003447061 6:6194392-6194414 AGGGAGGAGTGCAAAGCAGGGGG - Intronic
1005277066 6:24230683-24230705 CTTGAGGATTGGATATCAGAGGG + Intronic
1005928112 6:30461475-30461497 CTGGGTGGGTGGACAGCAGAGGG + Intergenic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006025331 6:31143180-31143202 CTAGAGGTGTGGAAAGAGGATGG - Intronic
1006391818 6:33763119-33763141 CTGGAGGAGAGGGGAGCAGTAGG - Intergenic
1006418489 6:33919169-33919191 CTGGAGGAGATGTGAGCAGAAGG - Intergenic
1007836978 6:44681531-44681553 CTGGCAGAGGGGAAAGAAGAGGG + Intergenic
1009509976 6:64538873-64538895 CTGGTGGAGTAGAAAGAACATGG - Intronic
1009905881 6:69868782-69868804 CTGGAGGACCAGAAAGTAGATGG - Intronic
1010839658 6:80634318-80634340 ATGGAAGAGTGGAAAGAACATGG + Intergenic
1011065310 6:83319834-83319856 CTGGAGGAGTAGGAATCATATGG - Intronic
1011212219 6:84967060-84967082 TTGGAGGAGGGGAAAGGACAAGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012297711 6:97545843-97545865 CTTGAGGAGAGGAGAGGAGAGGG - Intergenic
1012423505 6:99090127-99090149 ATGAAGGATTGGAAAGCAAAGGG - Intergenic
1012717969 6:102701263-102701285 CTGGATGAGGGGAATGCAGTGGG + Intergenic
1013232554 6:108170472-108170494 CTGGAGGAGTGTCAGGGAGAGGG - Intronic
1013335943 6:109161378-109161400 CTGCTGGAGCAGAAAGCAGAGGG + Intronic
1013626624 6:111943985-111944007 CTGAGGGGGTTGAAAGCAGAAGG + Intergenic
1014778002 6:125533014-125533036 CTGGATGACCTGAAAGCAGATGG - Intergenic
1016041256 6:139433993-139434015 GTGGAGGACTGGATAGTAGATGG + Intergenic
1016090191 6:139968534-139968556 TTGGAGGAGTGGGAAGGAGCAGG - Intergenic
1016873658 6:148843135-148843157 CAGGGGGAATGGGAAGCAGATGG + Intronic
1017435554 6:154412429-154412451 CTGGAGTAGTGGCAAGAAAAGGG - Intronic
1017638434 6:156466348-156466370 CAGGAGAAGTTAAAAGCAGAGGG - Intergenic
1017772353 6:157652966-157652988 CTTGAAGAATGGAGAGCAGAGGG + Intronic
1017978761 6:159380307-159380329 CTGGAAGAGAGGGAAGCTGATGG - Intergenic
1018607958 6:165618453-165618475 CTGGAGAAGAGGAAGGCTGATGG - Intronic
1018793189 6:167165623-167165645 CTGGAGGAGAGGTGAGCAGGGGG + Intronic
1018969332 6:168515446-168515468 CTCGTGGAGCGGAAAGCGGACGG - Intronic
1018992780 6:168686722-168686744 CTCAAGGAGAGGGAAGCAGAGGG - Intergenic
1019246777 6:170714544-170714566 CTGGATGAGAGCAAAGCAGCAGG - Intergenic
1019435602 7:1020747-1020769 CTGCAGGGGTGGTCAGCAGACGG - Intronic
1019686737 7:2386046-2386068 CAGGGGGAGTGGACTGCAGAGGG + Intergenic
1020408723 7:7866616-7866638 TTGAGGGAGTGGAAAGCAGTAGG + Intronic
1020490048 7:8770819-8770841 ATGTAGAATTGGAAAGCAGAAGG + Intergenic
1020888716 7:13852189-13852211 CTGGATGGCTTGAAAGCAGATGG - Intergenic
1022097008 7:27147458-27147480 CTCGGGCAGTGGCAAGCAGAGGG - Exonic
1022638538 7:32160076-32160098 CAGGAGGAGTGGAAAGGGGCTGG + Intronic
1022739322 7:33106537-33106559 CTGGAAGATTGGAAACAAGAAGG + Intronic
1023062626 7:36343324-36343346 CTGTAGGAGAGGAGAGGAGAGGG + Intronic
1023792779 7:43766696-43766718 AAGGGGGAGTTGAAAGCAGAAGG + Intronic
1023846294 7:44122670-44122692 GTGGAGGAGTGGGAACCAGGAGG - Intronic
1023983375 7:45082095-45082117 CTGGAGGAAGGTAAGGCAGAGGG - Exonic
1025233469 7:57218319-57218341 CTGGAGACCTGGATAGCAGATGG + Intergenic
1026447622 7:70499338-70499360 CTGGAGGAGTTCCAGGCAGAGGG + Intronic
1026886306 7:73949414-73949436 CAGGAGAAGAAGAAAGCAGAAGG - Intergenic
1029034933 7:97509439-97509461 CTGGAGGAGTGAGCAGCAGGAGG - Intergenic
1029438550 7:100575305-100575327 CTGGGGGAGAGGAGAGCAGGTGG + Intronic
1029444377 7:100604383-100604405 CGGGAGGAGGGGAGAGAAGACGG - Intronic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1032471889 7:132184771-132184793 CTTGAGGAGTTTACAGCAGAGGG + Intronic
1032477705 7:132223678-132223700 CTGGATGAGCCCAAAGCAGAGGG + Intronic
1032797724 7:135290952-135290974 CATGAGGAGTTGAAAGCAGTGGG + Intergenic
1032983595 7:137313163-137313185 TTGGAGGTGGGGAAATCAGAAGG - Intronic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1035501365 8:93417-93439 CTGGATGAGAGCAAAGCAGCAGG + Intergenic
1036119761 8:6003077-6003099 CTGAAGCAGTGCAAAGCAGGAGG + Intergenic
1036505093 8:9347730-9347752 CTGGAGGAGTGGGAGGCACTAGG - Intergenic
1036793143 8:11736615-11736637 CTGGAGGAGTGGTGGGCAGAAGG + Intronic
1036962460 8:13259985-13260007 CAGGAGAAATGAAAAGCAGAAGG + Intronic
1039314572 8:36356945-36356967 CTGGGGGAATGGAAAGCAGCAGG + Intergenic
1039588094 8:38723712-38723734 CTGGGGGCGTGGGGAGCAGAGGG - Intergenic
1039888386 8:41668541-41668563 CTGCAGGACTGGGATGCAGACGG - Exonic
1041021484 8:53642969-53642991 CTTGGGGAGAGGAGAGCAGAAGG - Intergenic
1041930180 8:63277795-63277817 GTGGAGGCATGAAAAGCAGAAGG - Intergenic
1042508282 8:69584336-69584358 CAGGAGCAGGCGAAAGCAGAGGG + Intronic
1042699861 8:71600533-71600555 CTGGAGGAGAGAGAGGCAGAAGG - Intergenic
1042928699 8:73992738-73992760 CTGGAAGAGGGGAATGCAAAAGG - Intronic
1043042028 8:75275642-75275664 CTTGAGGAGAGGAGAGGAGAGGG + Intergenic
1043518572 8:81019684-81019706 CTGCAGGAGTGGCAAGCTGATGG + Intronic
1044413271 8:91908804-91908826 CTGTAGCAGTGGAAATAAGAGGG - Intergenic
1044589552 8:93900549-93900571 ATGAAGGAAAGGAAAGCAGAGGG - Intronic
1044911532 8:97064845-97064867 GTGGAGTCTTGGAAAGCAGAGGG + Intronic
1044946404 8:97393842-97393864 CTGGAGTAGGCGAGAGCAGAAGG + Intergenic
1046362622 8:113182945-113182967 CTGGTGGAGCAGAAAACAGATGG + Intronic
1048229922 8:132628487-132628509 CTGGAGCAGCCTAAAGCAGAGGG - Intronic
1048311879 8:133329045-133329067 ATGGAGGGGTGCAAGGCAGAGGG - Intergenic
1048402042 8:134081293-134081315 CAGGAGCAGTGGGAGGCAGATGG - Intergenic
1048416165 8:134229915-134229937 CTGGAGGAGTCCAAAGGAGCAGG - Intergenic
1048582822 8:135744533-135744555 CTGAAGGAGTGAATAGCACAAGG - Intergenic
1048912507 8:139149453-139149475 CTGGTGTAGTGGAAAGCCAAAGG + Intergenic
1049180391 8:141219150-141219172 CTGGAGAAGGAGAAAGCAGTAGG + Intronic
1049238191 8:141523201-141523223 CTGGAGCAGGGGCAAGGAGAGGG - Intergenic
1049315555 8:141965151-141965173 CTGGAGGATTGGAAGGGAGCAGG - Intergenic
1049750017 8:144278601-144278623 CTGGAGACGTGGACAGCAGGAGG + Intronic
1050831083 9:10014321-10014343 ATGGAGAAGTGGAAAGAATATGG - Intronic
1050939343 9:11439705-11439727 CTGCAGGAGTGGAATCCAAATGG + Intergenic
1051029036 9:12651887-12651909 CTCATGGAGTGGAAGGCAGAGGG - Intergenic
1051574622 9:18600623-18600645 CTAGATGAGATGAAAGCAGAAGG - Intronic
1053010671 9:34631042-34631064 CTGGAAGACTGGAGAGCAGAGGG + Intergenic
1053052684 9:34975028-34975050 CTGGAGGTGTGGAGAGCAGTTGG - Intronic
1053632415 9:39957950-39957972 CTTGAGGAGTTGAGAGCAGTGGG - Intergenic
1053773345 9:41505581-41505603 CTTGAGGAGTTGAGAGCAGTGGG + Intergenic
1054211473 9:62292747-62292769 CTTGAGGAGTTGAGAGCAGTGGG + Intergenic
1054313510 9:63556106-63556128 CTTGAGGAGTTGAGAGCAGTGGG - Intergenic
1054863312 9:69974947-69974969 CTGAAGGAGTGGAAAGGTGGAGG - Intergenic
1055043779 9:71904013-71904035 CTGGAAGAGTGGATAGAATATGG - Intronic
1055474345 9:76646668-76646690 CTGGGGGAGTAGAGACCAGATGG - Intronic
1055509104 9:76977276-76977298 TTTCAGGAGTGGAAAACAGATGG + Intergenic
1056318566 9:85415313-85415335 CTGGAAGATGGGAAAGCAGCAGG - Intergenic
1057596282 9:96418271-96418293 CTGCAGGGGTGGGAAGCAGCGGG + Exonic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058675251 9:107394607-107394629 ATGGGGGAGTAGAAAGCACAGGG + Intergenic
1059154952 9:111981346-111981368 AGGGAGGAGTGGAAAGGAGGGGG - Intergenic
1059279975 9:113124599-113124621 CTGGAGCAGAGGAAAGCAATTGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1060424664 9:123494253-123494275 CTGGAGCAGTGCGAAGCATATGG + Intronic
1060528248 9:124332590-124332612 ATGGTGGATTGGAAAGCAGCTGG - Intronic
1061264521 9:129497402-129497424 TTGGAGGAGTGGAAGGCACAAGG + Intergenic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1061389473 9:130309620-130309642 GTGGAGGAGTGGACACCAGCGGG + Intronic
1061663891 9:132148922-132148944 TGGGAGGAGTGGAAAGCGGGTGG + Intergenic
1061836881 9:133335475-133335497 CAGGAGGAGAGGAGAGCAGCAGG - Intronic
1062203770 9:135323606-135323628 CTGGAGCAGTGGAAAACCTATGG + Intergenic
1203607550 Un_KI270748v1:69995-70017 CTGGATGAGAGCAAAGCAGCAGG - Intergenic
1186199360 X:7141035-7141057 CTGGAGGAGAGGAAGAGAGATGG - Intronic
1186432849 X:9519768-9519790 CTGGGAGAGTGGCAAGGAGAGGG + Intronic
1186650189 X:11551072-11551094 CTGGAGGAGTGGTTAGAACAAGG + Intronic
1186976990 X:14917965-14917987 CCGGAGGAGGGAGAAGCAGATGG + Intronic
1187273253 X:17797766-17797788 CTGGATGAGGGGCAGGCAGAGGG + Intergenic
1187717037 X:22113099-22113121 CAGTAGGGGTGGAAAGCAGCTGG - Intronic
1188254354 X:27942090-27942112 TGTGAGGAGTGGAAAGCAGAGGG - Intergenic
1189679109 X:43496485-43496507 CTGGAGGACTGGAAAAGAGTGGG + Intergenic
1190635720 X:52431885-52431907 CTGGAAGGGTGGTATGCAGAAGG + Intergenic
1190638135 X:52456602-52456624 CTGGAAGGGTTGTAAGCAGAAGG - Intergenic
1190640140 X:52476397-52476419 CTGGAAGGGTGGTAGGCAGAAGG - Intergenic
1190647532 X:52536468-52536490 CTGGAAGGGTGGTAGGCAGAAGG + Intergenic
1190678522 X:52803847-52803869 CTGGAAGGGTTGTAAGCAGAAGG + Intergenic
1192146396 X:68685862-68685884 AGGGAGGAGTGAAAAGCAGGGGG + Intronic
1192148199 X:68695594-68695616 CTGAAGGTGTGCAAAGCAAAGGG + Intronic
1192226458 X:69231515-69231537 ATGGGGGAGTGGAAGGCAGGTGG + Intergenic
1195086283 X:101417470-101417492 CTGGAGCAGGGGAAGGCAAAGGG - Intergenic
1195129579 X:101839829-101839851 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195131547 X:101858761-101858783 GTGGAGGAGTAGAAAGCACTGGG - Intergenic
1195176660 X:102320000-102320022 AGGCAGGAGTGGAAGGCAGAGGG + Intronic
1195182204 X:102367093-102367115 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195254926 X:103081610-103081632 AGGCAGGAGTGGAAGGCAGAGGG - Intronic
1195596275 X:106693793-106693815 CTGGAGGAGGGGCAAGCAAAGGG + Intronic
1195635987 X:107116710-107116732 CTGGAGGAGCTGGAAACAGAAGG - Exonic
1196270113 X:113700044-113700066 CTTGAGGAGAGGAGAGGAGAGGG - Intergenic
1196827970 X:119755884-119755906 CAGAGGGAGTGGAAAACAGAAGG - Intergenic
1197836749 X:130702719-130702741 CTAGAGGAGAGGAAAGGAGACGG - Intronic
1199359457 X:146901908-146901930 ATAGAGGACTTGAAAGCAGAGGG + Intergenic
1199612337 X:149629198-149629220 CTGGAGGAGAGGAAAAGAGAGGG + Intronic
1201057078 Y:10005185-10005207 CTGGAAGAGTAGAGAGCAGCTGG + Intergenic
1201577747 Y:15478684-15478706 CTGGCGGAGGTGAAAGCTGAGGG + Intergenic
1201690890 Y:16763196-16763218 CTTGATGAGTTGAAAGAAGAAGG + Intergenic
1201759711 Y:17523413-17523435 CTGAAGGGGTGGAGAGCACAAGG + Intergenic
1201841843 Y:18382577-18382599 CTGAAGGGGTGGAGAGCACAAGG - Intergenic