ID: 1061324677

View in Genome Browser
Species Human (GRCh38)
Location 9:129856403-129856425
Sequence ACCTGTTATCAGCACTGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061324673_1061324677 11 Left 1061324673 9:129856369-129856391 CCCTTGTGGCCATCAGGGGTGTA 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1061324677 9:129856403-129856425 ACCTGTTATCAGCACTGCACAGG 0: 1
1: 0
2: 2
3: 16
4: 164
1061324668_1061324677 30 Left 1061324668 9:129856350-129856372 CCTGTCTGCAGGTAAAAGACCCT 0: 1
1: 0
2: 0
3: 46
4: 98
Right 1061324677 9:129856403-129856425 ACCTGTTATCAGCACTGCACAGG 0: 1
1: 0
2: 2
3: 16
4: 164
1061324675_1061324677 2 Left 1061324675 9:129856378-129856400 CCATCAGGGGTGTAGAGCTGCTT 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1061324677 9:129856403-129856425 ACCTGTTATCAGCACTGCACAGG 0: 1
1: 0
2: 2
3: 16
4: 164
1061324674_1061324677 10 Left 1061324674 9:129856370-129856392 CCTTGTGGCCATCAGGGGTGTAG 0: 1
1: 0
2: 0
3: 12
4: 118
Right 1061324677 9:129856403-129856425 ACCTGTTATCAGCACTGCACAGG 0: 1
1: 0
2: 2
3: 16
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061324677 Original CRISPR ACCTGTTATCAGCACTGCAC AGG Intronic
905253263 1:36663942-36663964 TCCTGTCATCAGCACTGTCCAGG + Intergenic
907766044 1:57411528-57411550 ACCTGTTATTCACACTCCACAGG + Intronic
909497796 1:76298789-76298811 ACCTGCTATCAGCACCACATGGG + Intronic
909664196 1:78115538-78115560 ACCTATCATCAGCACTGTCCAGG - Intronic
910229975 1:84975237-84975259 ACCTGAAGTCAGCACAGCACTGG - Intronic
911981226 1:104569096-104569118 ACCTGAAACCAGCACAGCACTGG - Intergenic
912633164 1:111266976-111266998 ACCTGAAGTCAGCACAGCACTGG + Intergenic
915731311 1:158056282-158056304 ATCTGTCATCACCACTGCAGGGG - Intronic
918989846 1:191684608-191684630 ACCTGAAACCAGAACTGCACTGG + Intergenic
921513050 1:216055436-216055458 AGATTTTATCAGCACTGCAGCGG - Intronic
922921578 1:229309783-229309805 ACCTGCTATGACCACTGCAATGG - Intergenic
1066649614 10:37642305-37642327 ACCTGAAACCAGCACAGCACTGG + Intergenic
1067032504 10:42887854-42887876 ACCTGAAACCAGCACAGCACTGG + Intergenic
1068266607 10:54657453-54657475 ACCTGTTCTCAGAAAGGCACAGG + Intronic
1069248904 10:66244445-66244467 ACCTGAAATCAGCACAGCACTGG - Intronic
1074604390 10:114946308-114946330 ACCTGTATACAGCACTTCACAGG - Intronic
1075830486 10:125407020-125407042 ACCTGAAACCAGCACAGCACTGG + Intergenic
1075915636 10:126164055-126164077 ACATGTTGTCAGCATTGAACTGG - Intronic
1080183793 11:29455029-29455051 AGATGTTGTCAGCACTGCAGAGG + Intergenic
1080766293 11:35300389-35300411 ACCTCTTAACACCACTGCCCTGG - Intronic
1082857955 11:57826330-57826352 ACCTGTTAACATTACTGAACTGG - Intergenic
1083150246 11:60787301-60787323 ACCTCCTAGCAGCCCTGCACAGG + Intronic
1084766418 11:71311898-71311920 ACCTGATATCCCCACTCCACAGG - Intergenic
1087969834 11:104466172-104466194 ATCTGTTTGCAGCACTGAACTGG - Intergenic
1088938120 11:114425392-114425414 ACCTGAAGTCAGCACAGCACTGG + Intronic
1088944395 11:114495160-114495182 ACCTGAAACCAGCACAGCACTGG + Intergenic
1090628826 11:128628422-128628444 TTCTCTTATCAGCACAGCACGGG + Intergenic
1096737814 12:53669641-53669663 ACCAGTTAGCAGCAGTGCACAGG + Intronic
1099024591 12:77448890-77448912 ACCTGAAGTCAGCACAGCACTGG - Intergenic
1099111038 12:78561309-78561331 ACTTGCTATCAGCATAGCACTGG + Intergenic
1099548374 12:84012955-84012977 TCCTGTTTTCAGCACAGCACTGG + Intergenic
1101604021 12:106234210-106234232 TCCTGATATCACCACTGCAACGG - Intergenic
1103178982 12:118891194-118891216 ACCTCTTAACACCACCGCACTGG + Intergenic
1104890790 12:132139196-132139218 TCCAGTGATCAGCACTGCTCTGG + Exonic
1110266419 13:73542654-73542676 ACCTGTTTTCCACACTGCAAAGG - Intergenic
1110810685 13:79808011-79808033 ACCTGTTGTCAGCCTTGCTCTGG - Intergenic
1112820479 13:103328804-103328826 AACTGATATCAGCACTGGCCAGG - Intergenic
1116354922 14:43915387-43915409 ACCTGAAACCAGCACAGCACTGG - Intergenic
1116669348 14:47821348-47821370 ACCTGATGTCAGCACAGCACTGG + Intergenic
1117635119 14:57734897-57734919 GCCTGTGATCAGCACTTCTCTGG + Intronic
1118348683 14:64958253-64958275 ACCTCCCACCAGCACTGCACTGG - Intronic
1119048721 14:71344973-71344995 AAATGTCATCTGCACTGCACAGG + Intronic
1121689227 14:95863991-95864013 ACTTGTTTTCAGCTCTGCCCAGG - Intergenic
1122001682 14:98662341-98662363 ACCTCTGTTCAGCACTGCATTGG + Intergenic
1124344786 15:28914885-28914907 GCCTGTTATCTGCAGTGCACAGG + Intronic
1124376887 15:29134102-29134124 AGTTGTCATCAGCACTGCAAGGG - Intronic
1125008882 15:34848944-34848966 ACCTCTTTTCAGCATTGTACTGG + Intergenic
1125884903 15:43221216-43221238 AGATGTTATCTGGACTGCACTGG + Exonic
1127503538 15:59576963-59576985 ACCTGTAATCCCCACTGCTCAGG - Intergenic
1127905426 15:63372685-63372707 ACCTGTGCTCAGGGCTGCACAGG - Intronic
1130239402 15:82172329-82172351 GCCTGTTCTCAACACTGCTCTGG - Intronic
1131105110 15:89728644-89728666 CCCAGTTATCAGCACAACACTGG + Intronic
1132713046 16:1277786-1277808 CCCTCTGGTCAGCACTGCACGGG - Intergenic
1137321047 16:47382775-47382797 ACCTGTTAACTGCACTGAAATGG + Intronic
1138027146 16:53531014-53531036 ACATTTTAACAGCACTCCACTGG + Intergenic
1141116264 16:81312589-81312611 ACCTGTAATCCCCACTGCTCAGG - Intergenic
1143282695 17:5766643-5766665 CCCTGTTACCAGCACAGCATGGG + Intergenic
1144589485 17:16512188-16512210 ACCTCTTATCCCCACTGCTCTGG + Intergenic
1150634026 17:66900059-66900081 ACCTGTAATCTCCAATGCACAGG + Intergenic
1150668934 17:67172291-67172313 AAATGTGCTCAGCACTGCACTGG - Intronic
1151241327 17:72760567-72760589 ACATGTTCTCAGCACTCCTCAGG - Intronic
1151645975 17:75431998-75432020 AGCTGTAAACACCACTGCACTGG - Intergenic
1155228705 18:23753019-23753041 GCCTATTGTCAGCACTGCAGAGG + Intronic
1159448963 18:68575857-68575879 ACATGTTATGAGCACTGGATAGG - Intergenic
1159945560 18:74442115-74442137 ACCTGTAATCAAAACAGCACGGG + Exonic
1160295469 18:77633178-77633200 ACCTGTAATGAGCAATGCATTGG - Intergenic
1160426989 18:78784942-78784964 ACCATTTATCAGCACATCACTGG - Intergenic
1162492377 19:11000939-11000961 GCCTGTTCTCAACACTCCACAGG - Intronic
1166757555 19:45202758-45202780 ACCTGAAATCAGCACGGCACTGG + Intronic
1167549165 19:50147777-50147799 ACCCGAAAGCAGCACTGCACAGG - Intergenic
1168711629 19:58503988-58504010 ACCTGTAATCACAACTGCTCAGG + Intronic
926170091 2:10547694-10547716 ATCTGCTGTCTGCACTGCACTGG - Intergenic
926741383 2:16114316-16114338 AGCTGTCACCAGCACTGCAGAGG - Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
931866139 2:66413738-66413760 GCCTGTTATCAGCTCTGGATTGG + Intergenic
933727253 2:85433951-85433973 AGCTGTTCTCAGCCCTGCCCTGG + Intronic
937139395 2:119586278-119586300 ACCTGCCCCCAGCACTGCACAGG + Intronic
938736511 2:134191304-134191326 ACCTGTAAACAGTATTGCACTGG - Intronic
943099433 2:183470860-183470882 ACCTGAAGTCAGCACAGCACTGG + Intergenic
944078745 2:195760472-195760494 ACCTGAAACCAGCACAGCACTGG - Intronic
946668809 2:222080180-222080202 ACCTGTTATCAGAAATGGCCTGG + Intergenic
947463259 2:230321309-230321331 ACCAGTTATGAGAAATGCACAGG + Intergenic
948542653 2:238701517-238701539 ACCTTCTGTCAGCCCTGCACAGG + Intergenic
1169623952 20:7541163-7541185 ACCTGACATCAGCACAGCAATGG - Intergenic
1170049141 20:12122386-12122408 CTCTGTTATCAGCAATGCATGGG - Intergenic
1172068368 20:32237763-32237785 CCCTGTTAACAGCCCTGCACTGG - Exonic
1172216182 20:33237461-33237483 ACCTGTTACCTGCATTGCACAGG - Intronic
1174948124 20:55011334-55011356 ACCTGGTTTCAGCAGTCCACTGG + Intergenic
1175573302 20:60040385-60040407 ACCTTTTATCAACACTGCCCTGG - Intergenic
1177212927 21:18092060-18092082 ACCTGAAACCAGCACAGCACTGG - Intronic
1179373227 21:40826290-40826312 TCCTCTCCTCAGCACTGCACTGG - Intronic
952203031 3:31151080-31151102 ACCTGAAACCAGCACAGCACTGG + Intergenic
954283702 3:49602779-49602801 TCCTCATAACAGCACTGCACTGG - Intronic
954621439 3:51998275-51998297 ACCTGTGCTCAGCACCCCACAGG - Intergenic
954654930 3:52188544-52188566 ACCTGGGATCAGCAGTGCAGAGG - Intergenic
955359268 3:58258938-58258960 TCCTGCTACCAGCACTGCAAGGG - Intronic
959110649 3:102118299-102118321 ACCTGCCAACAACACTGCACTGG + Intronic
962354134 3:134679221-134679243 ACCTGTCTTGAGCACTGCACAGG - Intronic
963763251 3:149307290-149307312 ACCTGAAACCAGCACAGCACTGG + Intergenic
964179501 3:153866022-153866044 ACCTGAAGCCAGCACTGCACTGG - Intergenic
964582806 3:158259522-158259544 ACCCGTACTCAGCACAGCACTGG + Intronic
966841627 3:184094111-184094133 ACCTGTAATCACCGCTACACAGG + Intergenic
967551206 3:190797411-190797433 ACCTGAAACCAGCACAGCACTGG - Intergenic
967937214 3:194738706-194738728 CTCTGTTGCCAGCACTGCACAGG + Intergenic
968939276 4:3629687-3629709 ACCTGTTGTCAGCACCGCACTGG - Intergenic
969306105 4:6327157-6327179 ACCTGTTCTGAGCCCTTCACTGG - Intronic
971393897 4:26211016-26211038 ACCTGTGCTCTGCACAGCACAGG - Intronic
974292280 4:59948172-59948194 ACCTGAAGTCAGCACAGCACAGG - Intergenic
979111381 4:116761889-116761911 ACCTGAAACCAGCACAGCACTGG - Intergenic
980442600 4:132867932-132867954 ACCTGAAACCAGCACAGCACTGG - Intergenic
980686937 4:136240867-136240889 ACCTGAAGTCAGCACAGCACTGG - Intergenic
981656757 4:147120451-147120473 ACCTGTAATCACAACTACACAGG - Intergenic
983017330 4:162629043-162629065 AGCTGAAATCAGCACAGCACTGG - Intergenic
985896614 5:2752734-2752756 ACCTGTAATGCCCACTGCACCGG - Exonic
986893327 5:12335330-12335352 TCCTGTTCTAAGCATTGCACTGG - Intergenic
987042816 5:14078598-14078620 ACCTGTAATCCCCACTGCTCAGG + Intergenic
987823207 5:22992091-22992113 ACCTGAAGTCAGCACAGCACTGG - Intergenic
988001835 5:25359096-25359118 ACCTGAAACCAGCACAGCACTGG - Intergenic
988728425 5:33946525-33946547 CTCTGTTATAAGCACTGCATAGG + Intronic
991017559 5:61948170-61948192 ACCTGTTGTCAGCTCTGTGCAGG - Intergenic
991530969 5:67613696-67613718 ACTTGCTATCATCAATGCACGGG + Intergenic
995290164 5:110443028-110443050 ACCTGATGTCAGCACAGCACTGG + Intronic
996166321 5:120228482-120228504 ACCTGAAGTCAGCACAGCACTGG + Intergenic
1002163335 5:177330148-177330170 ACCTGTTAAAACCACTGCAGGGG + Intergenic
1002294825 5:178224462-178224484 ACGTGTGGTCAGCAGTGCACAGG - Exonic
1004885294 6:20045246-20045268 ACCTGCTTTCAGCACTGCTGGGG - Intergenic
1005006626 6:21293660-21293682 ACCTGGGATCAGAACAGCACTGG - Intergenic
1007966744 6:46010348-46010370 TGCTGCTATTAGCACTGCACTGG + Intronic
1008376515 6:50797980-50798002 ACCTGTCATCACCACACCACTGG + Intergenic
1009702697 6:67203138-67203160 ACCTGTTTTCAGAAGTGCACAGG + Intergenic
1011402001 6:86973416-86973438 AGCTGTAATCAGCACAGCAGTGG - Intronic
1012306871 6:97669340-97669362 CTCTATTATCAGCAGTGCACTGG - Intergenic
1012612933 6:101237647-101237669 CTCTGTTATGAGGACTGCACAGG - Intergenic
1015417351 6:132964379-132964401 ACCAGTTCTCAGCTCTGCTCTGG + Intergenic
1015543254 6:134337382-134337404 GCCTGTTTTCAGAACTGAACTGG - Intergenic
1017924721 6:158901161-158901183 ACCTGAAGTCAGCACAGCACCGG + Intronic
1018535932 6:164818818-164818840 ACCTGAAACCAGCACAGCACTGG - Intergenic
1021382311 7:19983246-19983268 ACCTGAAGTCAGCACAGCACTGG + Intergenic
1022273805 7:28836838-28836860 ACATTTTCTAAGCACTGCACTGG - Intergenic
1023817881 7:43964145-43964167 AGCTATGATCACCACTGCACTGG + Intergenic
1024632812 7:51263196-51263218 ACCTGTCATCTACACTGCACTGG + Intronic
1026351617 7:69520841-69520863 ACCTGTATTCAGCATTGTACTGG - Intergenic
1029885366 7:103864343-103864365 TGCAGTTAACAGCACTGCACTGG - Intronic
1031370622 7:120960610-120960632 TCCTGTGACCATCACTGCACTGG + Intronic
1031442655 7:121812637-121812659 ACCTGGTGCCAGCACTGCACTGG - Intergenic
1032683096 7:134205364-134205386 ACCTCTCATCAGCACTCCCCAGG + Intronic
1033489134 7:141824580-141824602 ACCTGAAGCCAGCACTGCACTGG + Intergenic
1034657994 7:152744551-152744573 ACCTCTCAACACCACTGCACTGG + Intergenic
1037521262 8:19682498-19682520 ACCTGTTGTCACCCCTGCCCGGG + Intronic
1040422847 8:47256653-47256675 ACCTGTGAGAAGCACTGGACTGG - Intergenic
1044162609 8:88938309-88938331 ACCTGTTATTGGCACTCTACTGG - Intergenic
1045124266 8:99072189-99072211 ACCTGATGCCAGCACAGCACTGG + Intronic
1045733304 8:105266709-105266731 ACCTGTAGACAGCACAGCACTGG + Intronic
1046734503 8:117762524-117762546 ACCTGCCAACAGCACTGCTCAGG - Intergenic
1053110320 9:35453971-35453993 ACCTGAAGTCAGCACAGCACTGG - Intergenic
1054451481 9:65405634-65405656 GCCTGTTGTCAGCACTGCACTGG + Intergenic
1056418484 9:86400833-86400855 ACCTGTAATCACCGCTGCTCAGG - Intergenic
1057487092 9:95494205-95494227 ATCTGTTATCAGCCTTGCCCAGG + Intronic
1060504201 9:124186078-124186100 ACATCTTAGCAGCACTGCCCCGG + Intergenic
1061324677 9:129856403-129856425 ACCTGTTATCAGCACTGCACAGG + Intronic
1061906342 9:133701285-133701307 AGCTGTTACCAGCACACCACAGG + Intronic
1188721426 X:33528055-33528077 ACCTGAAACCAGCACGGCACTGG + Intergenic
1189013332 X:37070078-37070100 ACCTGTAGCCAGCACAGCACTGG + Intergenic
1189405838 X:40721701-40721723 ACCTGAAGTCAGCACAGCACTGG - Intronic
1191883392 X:65864314-65864336 ACCTGTAATCCCCACTGCTCAGG - Intergenic
1192521523 X:71805171-71805193 ACCTGAACCCAGCACTGCACTGG - Intergenic
1193798049 X:85900679-85900701 ATCTGTAATCAGCACTGCCCTGG + Exonic
1194218815 X:91166969-91166991 ACCTGAAGTCAGCACAGCACTGG + Intergenic
1194288432 X:92039160-92039182 ACCTGAAACCAGCACAGCACTGG + Intronic
1194598985 X:95896684-95896706 GCCTGTTATCAGCATAGAACTGG + Intergenic
1195460887 X:105122882-105122904 ACCTGTTATCTGTTCTGTACAGG + Intronic
1196096641 X:111808074-111808096 ACCTGAAACCAGCACAGCACTGG + Intronic
1196532456 X:116805559-116805581 ACCTGATGCCAGCAATGCACTGG + Intergenic
1196579075 X:117358703-117358725 ACCTGAAGTCAGCACAGCACTGG + Intergenic
1197054009 X:122094824-122094846 ACCTGAAACCAGCACAGCACTGG - Intergenic
1197763025 X:130040793-130040815 ACGTGTTATCTGCACTCCACTGG + Intronic
1198430703 X:136564165-136564187 ACCTGTAGCCAGTACTGCACTGG + Intergenic
1198702466 X:139413215-139413237 ACCTGAAACCAGCACAGCACTGG + Intergenic
1198925492 X:141787755-141787777 ACCTGATGCCAGCACAGCACTGG + Intergenic
1199223239 X:145341037-145341059 ACCTGAAGTCAGCACAGCACTGG - Intergenic
1200555325 Y:4630723-4630745 ACCTGAAGTCAGCACAGCACTGG + Intergenic
1200605953 Y:5263725-5263747 ACCTGAAACCAGCACAGCACTGG + Intronic
1201404402 Y:13635413-13635435 ACCTGTAATCAGGCCTGCCCTGG + Intergenic