ID: 1061325618

View in Genome Browser
Species Human (GRCh38)
Location 9:129862251-129862273
Sequence GTTAATAATTGACCACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061325614_1061325618 19 Left 1061325614 9:129862209-129862231 CCTAGTAACTATCCTCAGGTGGC 0: 1
1: 0
2: 1
3: 6
4: 86
Right 1061325618 9:129862251-129862273 GTTAATAATTGACCACACCCAGG No data
1061325610_1061325618 30 Left 1061325610 9:129862198-129862220 CCCAAAATGTTCCTAGTAACTAT 0: 1
1: 0
2: 3
3: 28
4: 227
Right 1061325618 9:129862251-129862273 GTTAATAATTGACCACACCCAGG No data
1061325611_1061325618 29 Left 1061325611 9:129862199-129862221 CCAAAATGTTCCTAGTAACTATC 0: 1
1: 0
2: 1
3: 22
4: 166
Right 1061325618 9:129862251-129862273 GTTAATAATTGACCACACCCAGG No data
1061325617_1061325618 7 Left 1061325617 9:129862221-129862243 CCTCAGGTGGCAGGATGCAGGTC 0: 1
1: 0
2: 3
3: 12
4: 201
Right 1061325618 9:129862251-129862273 GTTAATAATTGACCACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061325618 Original CRISPR GTTAATAATTGACCACACCC AGG Intronic
No off target data available for this crispr