ID: 1061327647

View in Genome Browser
Species Human (GRCh38)
Location 9:129873989-129874011
Sequence CCCACACACCTGCCTCCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 360}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061327647_1061327652 12 Left 1061327647 9:129873989-129874011 CCAATGGGAGGCAGGTGTGTGGG 0: 1
1: 0
2: 3
3: 40
4: 360
Right 1061327652 9:129874024-129874046 CACCCCCAGTGAGACAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061327647 Original CRISPR CCCACACACCTGCCTCCCAT TGG (reversed) Intronic
900103178 1:971431-971453 CCCACACAGCTGCCTCCCTGGGG - Intronic
900115963 1:1028010-1028032 CTCACACCCCAGCCTCCCCTGGG - Intronic
900145559 1:1157480-1157502 GCCCCAGCCCTGCCTCCCATCGG + Intergenic
900403047 1:2480488-2480510 CCCACCTGCCTGCCTGCCATAGG - Intronic
900640390 1:3685581-3685603 CCCCTACCCCTGACTCCCATGGG + Intronic
901445219 1:9304288-9304310 GCCACACTCCTGGCTCCCCTGGG + Intronic
901792059 1:11658858-11658880 CCCACGCACCTCCCTCCACTTGG - Exonic
901934226 1:12616852-12616874 CCCACATTCCTGCCTCCCAAAGG - Intronic
902231437 1:15030118-15030140 CCCATGCACCTGCCTCTCCTAGG + Intronic
903070057 1:20722625-20722647 CCCCCATCCCTGTCTCCCATTGG - Intronic
904625249 1:31798662-31798684 CCCACCCAGCTGCCTCCCTCTGG - Intronic
904927590 1:34060924-34060946 CCCACCCACCTGTATCCCCTGGG + Intronic
904978561 1:34477508-34477530 CTCAAAGACCTGCCTCCCAAAGG + Intergenic
906096652 1:43228656-43228678 ACCACAGACCTGCCTCCGCTGGG + Intronic
907748899 1:57243463-57243485 CACACACACATGCATCTCATTGG - Intronic
907818460 1:57943471-57943493 ACTCCACCCCTGCCTCCCATTGG + Intronic
908380399 1:63592888-63592910 ACCACACACTTGACTACCATTGG - Intronic
909564419 1:77039109-77039131 CCCACCCACCTGCCTCCCACTGG + Intronic
910147345 1:84097498-84097520 CCCACACACACCCCTCCTATTGG - Intronic
910889481 1:92002322-92002344 CCCACATACCTACCTATCATTGG + Intronic
912072399 1:105827808-105827830 CCCAAACCCCTAACTCCCATTGG - Intergenic
912955399 1:114152070-114152092 CACACACACAAGCCTCCCCTTGG + Intronic
913187283 1:116380425-116380447 CCCAAACACCAGCCTCCAACAGG - Intronic
913576316 1:120178846-120178868 CCCATACACATTCCTGCCATTGG + Intergenic
915057546 1:153149106-153149128 CCCACACACCTCCCACACACAGG - Intergenic
915140822 1:153767523-153767545 CCCTCCCAACTGCCTCCCACAGG - Intronic
915530744 1:156500865-156500887 CCCCCACAGGTGCCTCCCATTGG - Intergenic
915585071 1:156840104-156840126 CCCCCACCCCTGCCTCTCATGGG - Exonic
916302735 1:163294016-163294038 CCCCCACAGCTGCTTTCCATGGG + Intronic
917494769 1:175530333-175530355 CACACACACCCGCCTCTCTTTGG + Intronic
918821980 1:189267930-189267952 CCCAGCCACCTACCTCCCAGAGG - Intergenic
919761624 1:201101752-201101774 CACACCCACCATCCTCCCATGGG - Intronic
920944142 1:210512336-210512358 CCCCCTCACCTGCTTCCCTTTGG + Intronic
922606875 1:226894980-226895002 CCCCCACACCTGCTTCCCAGGGG + Intronic
923621717 1:235585030-235585052 CCCTCCCACCTACCTCCTATGGG + Intronic
1062862631 10:822444-822466 GACACAGACCTGCCTGCCATGGG + Intronic
1062896844 10:1109885-1109907 CCCCCACACCTGATTCCAATAGG - Intronic
1063371515 10:5525609-5525631 CCCATCCCCCTGCCTCCCCTGGG + Exonic
1066682875 10:37952202-37952224 CCCACACTCCTGACACTCATAGG + Exonic
1067023803 10:42826571-42826593 CCCAGGCACCTGCCTCCCCAGGG - Intronic
1067065075 10:43099704-43099726 CCCACACCCCCGCCTGCCACAGG + Intronic
1067236934 10:44458984-44459006 CCCAGCCAACTGCCTCCCAGAGG + Intergenic
1067282119 10:44880654-44880676 TCCACACACCTGCCTTCCAGTGG - Intergenic
1067896863 10:50191649-50191671 CCCACAAACCTGCTTTCCAGAGG - Intronic
1067952108 10:50750384-50750406 CCCACAAACCTGCTTTCCAGAGG + Intronic
1069752160 10:70751694-70751716 CCCCCACCCCTGCCTCTCAAGGG - Intronic
1069999798 10:72367865-72367887 TCCACACACCTGCCAACCCTGGG - Exonic
1072782615 10:98260876-98260898 CCCACAACCCTGCCTCCTGTGGG + Intronic
1075296918 10:121285547-121285569 CCCACATCCCTGCCTTCCATGGG + Intergenic
1075677346 10:124304527-124304549 CCCACACACCTCCTTCACGTTGG + Intergenic
1076668259 10:132104977-132104999 CCCTCCCTCCTGCCTCCCCTGGG + Intronic
1076854846 10:133111072-133111094 CCAAGCCACCTGCCTGCCATGGG + Intronic
1076981914 11:209112-209134 CCTACACGCCTGCCACCCAACGG - Intronic
1077052055 11:571403-571425 CACAGACACCTGCCTTCCCTAGG + Intergenic
1077306678 11:1871726-1871748 CACACACACCCCCCTCCCAAAGG - Intronic
1078027292 11:7709131-7709153 CCCTCACATCTCCCTCCCAGGGG + Intergenic
1078068502 11:8093571-8093593 CCTACACCCCAGCCTCCCATGGG + Intronic
1078536561 11:12179572-12179594 CCGATCCACCTGCCTCCCAAGGG + Intronic
1079074458 11:17375229-17375251 CCCAGACACTTTCCTCCCAGAGG + Exonic
1081794795 11:45811824-45811846 CCCACAGACCGGCCTTCCTTTGG + Exonic
1082261229 11:50077437-50077459 GCCCAACTCCTGCCTCCCATCGG - Intergenic
1083457776 11:62790550-62790572 CCAACACACCTGGCTCCCCAAGG + Exonic
1083476988 11:62921291-62921313 CCCAAACACCTGGCTCCCAGGGG + Exonic
1083581923 11:63830497-63830519 CCCTCCCAGCTGCCTTCCATGGG + Intergenic
1084091603 11:66882587-66882609 TCCACACACCTACTTCCTATGGG + Intronic
1084231469 11:67756804-67756826 CCCAGAAGCCTGCCTCCCAGAGG - Intergenic
1084307992 11:68299131-68299153 TGCACACCCCTGCCTCCCCTCGG + Intergenic
1084421816 11:69064152-69064174 CCCAGACACCTGTCTGCCCTGGG + Intronic
1084569319 11:69949967-69949989 CCCACACACGTGCAGCCCATGGG + Intergenic
1085039362 11:73317822-73317844 CCCAAACCCCTGCATCTCATGGG - Intronic
1085304163 11:75475820-75475842 CCCAGACCCCTGCCTCAGATTGG + Intronic
1089465026 11:118679526-118679548 CCCACACCCCTACCTCTCACAGG + Exonic
1089519462 11:119054297-119054319 CCCACCCACCTGCTTCCAATGGG + Intronic
1090090549 11:123693556-123693578 ACCACACACCTGGCTCTCATTGG - Intergenic
1090203714 11:124873541-124873563 TACTCACATCTGCCTCCCATGGG - Intronic
1090831843 11:130425925-130425947 CCCCCACACCTGGCTCCTAGGGG - Intronic
1090963769 11:131580564-131580586 CCCACAGAACTGTCTCCTATTGG + Intronic
1091397755 12:164010-164032 CACACACACCAGCCTCGCCTAGG - Intronic
1091547321 12:1510124-1510146 CCCAAACACCTTCCTCCCTCTGG + Intergenic
1091847696 12:3669918-3669940 ACCACACACCTTTCTCCCACAGG - Intronic
1092408815 12:8239010-8239032 CCCAACCACCTCCCTCCCAGGGG + Intergenic
1092702529 12:11248018-11248040 CCCATTCACCTGCCACCCTTAGG - Intergenic
1092980445 12:13789429-13789451 CCCACTCCCCTGCATCCCCTGGG + Intronic
1096246542 12:49992228-49992250 CACACGCACCTGCCTACCTTGGG + Exonic
1100161443 12:91865385-91865407 CCCAGACCCCAGCCTCCCACTGG + Intergenic
1100826738 12:98481873-98481895 CTCACACAAGTGCCTCTCATTGG + Intergenic
1101862624 12:108495344-108495366 CCCACACACCTGTCAGTCATTGG + Intergenic
1102467005 12:113135796-113135818 CCCACAATCCCGCCTCCAATGGG + Intronic
1104010278 12:124925386-124925408 CCCACCCACCTGGCTGCCAGAGG + Intergenic
1104517942 12:129445301-129445323 CCCACACTCCACCCTCCCATAGG - Intronic
1104881162 12:132071509-132071531 CACACACAGCTGCCTGCCAATGG - Intronic
1105854407 13:24361791-24361813 CCCATCCACGTGCCTCCCGTGGG - Intergenic
1110650855 13:77939157-77939179 CCCCCACTCCTGCCTGCCAGAGG - Intergenic
1113429075 13:110233542-110233564 TCCAGACTCCTCCCTCCCATCGG - Intronic
1113578884 13:111414235-111414257 CCCACACATATGCCCCACATTGG - Intergenic
1113969485 13:114177456-114177478 CACTCACAGCTGCCTCCCACAGG - Intergenic
1114015031 14:18420605-18420627 CCCACACACTGACCTCACATAGG + Intergenic
1114334102 14:21670122-21670144 CCCATCCACCAGCCTCCCAGAGG - Intergenic
1115480671 14:33858107-33858129 ACCACATAACTGCCTCCTATTGG + Intergenic
1118966522 14:70591929-70591951 CCAATACACCTCCCTCCCAAGGG - Intronic
1119089055 14:71763381-71763403 TCCACACTCCTGCCTGCCACTGG + Intergenic
1119830331 14:77696533-77696555 CCAGCACCCCTGTCTCCCATGGG + Intronic
1120235138 14:81881933-81881955 CCCCCTCACGTGCCCCCCATCGG - Intergenic
1120381071 14:83780622-83780644 CCCAAATTCCAGCCTCCCATTGG - Intergenic
1121783896 14:96640234-96640256 CCCACCCACCTGCCTTTCAGAGG + Intergenic
1122111678 14:99507751-99507773 CCCCTACACCTGCTTCCTATTGG + Exonic
1122231437 14:100307977-100307999 TCCGCACACCTGCCTCCCTGAGG - Intergenic
1122277756 14:100603943-100603965 CTCTCACTCCTGCCTCCCACAGG + Intergenic
1122411131 14:101526760-101526782 GCCATCCACCTGCCACCCATGGG - Intergenic
1123424951 15:20163608-20163630 CCCAGGCACCTGCCTCCCCAGGG - Intergenic
1123534175 15:21170141-21170163 CCCAGGCACCTGCCTCCCCAGGG - Intergenic
1123692508 15:22850357-22850379 TCCTTACACCTCCCTCCCATTGG + Intronic
1123919720 15:25061839-25061861 CTCACACACCTGCTTCTCCTTGG - Intergenic
1130053592 15:80504085-80504107 CCCCCACACCTTCCTCCATTTGG + Intronic
1131074929 15:89489577-89489599 CTCACCCACCTGCCTCCCAGGGG + Intronic
1132335016 15:101042671-101042693 CCCTCTCCCCTGCCTTCCATGGG - Intronic
1132747882 16:1444497-1444519 GCCCCACACCTGCCTCCCTGGGG - Intronic
1132783461 16:1641642-1641664 CTCACACACCTGACTCCCAGAGG + Intronic
1132841621 16:1980874-1980896 CCCACGCGGCTGCCTCCCACTGG - Exonic
1133630053 16:7611748-7611770 CCCTCACACGTGCCTTCCAGAGG + Intronic
1133928201 16:10210992-10211014 CCCACAGCCCAACCTCCCATGGG - Intergenic
1134801894 16:17092121-17092143 CACACACACGTGCCTCACCTTGG - Intergenic
1136859909 16:33692137-33692159 CCCAGGCACCTGCCTCCCCAGGG + Intergenic
1138874198 16:60928968-60928990 CCCATACTCCTGCCTCTGATGGG - Intergenic
1139160977 16:64508110-64508132 CTCTCACAACTTCCTCCCATTGG + Intergenic
1139393684 16:66622733-66622755 ATCCCACACCTGCCTCTCATGGG + Intronic
1139475469 16:67200537-67200559 CCCACCCACCTTCCTCACAAAGG - Exonic
1139636226 16:68260114-68260136 CCCACACACCAGCCACAGATAGG + Exonic
1139958776 16:70705883-70705905 CCCACACTCTTGCCTCTCATGGG - Intronic
1140870089 16:79098332-79098354 CACAGACACCTGACTCCCAGTGG + Intronic
1141612222 16:85188086-85188108 ATCCCACACCTGCCTCCCCTTGG - Intergenic
1141721158 16:85756061-85756083 CCCACAGCTCTGCCTCCCTTAGG + Intergenic
1141927508 16:87178999-87179021 CCCACCCCCCTTCCCCCCATTGG + Intronic
1141995579 16:87634689-87634711 CCGCCTCACCTGCCTCCTATAGG - Intronic
1142132094 16:88435819-88435841 CCCAGACACCTTCCTCTGATCGG - Exonic
1203121414 16_KI270728v1_random:1540316-1540338 CCCAGGCACCTGCCTCCCCAGGG + Intergenic
1142698385 17:1645693-1645715 CCCACCGAGCTGCCTGCCATGGG - Exonic
1143167202 17:4902751-4902773 CCCACACCCCTGCCTGCGATGGG + Exonic
1143251032 17:5523131-5523153 CCACCACACCTGCCTCTCACTGG - Intronic
1143337962 17:6187624-6187646 CCCACAGCCCAGACTCCCATAGG - Intergenic
1145815284 17:27790841-27790863 CACTCACACATGCCTCCCCTAGG + Intronic
1146059393 17:29596535-29596557 CCCACACATGTCCCTCCCACGGG - Intronic
1146959566 17:36962074-36962096 CCTACACTCCTGCCTCCACTAGG + Intronic
1147129106 17:38395624-38395646 CACACACACCTTCCTCCCTCTGG - Intronic
1147561965 17:41514785-41514807 CCCACACATCTGACTCCTCTAGG + Intronic
1147610797 17:41800934-41800956 ACCTCACTCCTTCCTCCCATAGG - Intergenic
1147979871 17:44267924-44267946 CCCACCCACCTGCACCCCCTTGG + Intronic
1147993995 17:44351464-44351486 CCCACCCACCCGCCACCCCTGGG - Intronic
1148065694 17:44867991-44868013 CACACACACATTCCTCCCCTGGG - Intronic
1148132559 17:45270798-45270820 CCCATCCACCTGCCTCCTAACGG - Intronic
1148619745 17:49025657-49025679 CCCAAACACTTACTTCCCATCGG - Exonic
1149360363 17:55888927-55888949 CCCACCCACCTGCCACTCCTTGG + Intergenic
1149666625 17:58369397-58369419 CCCACATCCCTGCCTGCCATGGG + Intronic
1149994230 17:61398567-61398589 ACCACGCACCTGCTTCCAATCGG - Intergenic
1150131165 17:62670019-62670041 CCCACACCCGGGCCTCCCAGCGG - Intronic
1151196087 17:72432070-72432092 CATCCCCACCTGCCTCCCATAGG + Intergenic
1151445439 17:74160638-74160660 TGCACAGACCAGCCTCCCATAGG + Intergenic
1151663429 17:75531789-75531811 CCCACAGCCCTGCCTCTCAGAGG + Intronic
1152007978 17:77694512-77694534 CCCACTCACCTTCTTCCCAGAGG + Intergenic
1152098386 17:78286454-78286476 CCCCCACCCCTGCCTCCCCTGGG + Intergenic
1152594474 17:81231735-81231757 CCCCCACTCCTGTCTCGCATGGG + Intronic
1152681744 17:81671984-81672006 CCCGCCCACCTCCCTCCCATAGG - Intronic
1152854361 17:82655775-82655797 ACCACACCCCTGCCTCCCCGTGG + Exonic
1153565715 18:6415064-6415086 CGCAGCCACCTCCCTCCCATGGG - Intronic
1153586432 18:6625589-6625611 CCCACCCAACTTCCTCCCTTTGG + Intergenic
1155222966 18:23702073-23702095 CCCATATACCTGCCTACCGTTGG - Intronic
1155588602 18:27398468-27398490 CCCACACACATGCATCCTATTGG + Intergenic
1158252933 18:55509734-55509756 CCCTCAAATCTGCCTCCCAGAGG + Intronic
1159434591 18:68399359-68399381 CACACACATCTCCCTCCTATTGG + Intergenic
1159475464 18:68915266-68915288 TCCTCACACCTGCCTCACCTTGG - Intronic
1159497456 18:69224501-69224523 CCCACACAGCTGTCTCCAAGTGG - Intergenic
1159886694 18:73914392-73914414 CTTACACACCTTCCTCCCAGGGG + Intergenic
1160314345 18:77827020-77827042 CCCACCCTGCTGCCTACCATTGG - Intergenic
1160463471 18:79056818-79056840 CCCACACCCTTGCCTCCTACAGG + Intergenic
1160509607 18:79445842-79445864 ACCCCACACCTCCCTCCCCTGGG + Intronic
1160805993 19:992369-992391 CCCACACACCAGCCTTCCTGCGG + Intronic
1161293526 19:3507876-3507898 CCAGCACACCTGCCTCCACTTGG - Intronic
1161685945 19:5702465-5702487 CCCCCACTCCTCCCTCCCAGAGG - Intronic
1162408385 19:10489639-10489661 CCCACCCACCTGCCCCGCTTCGG + Exonic
1163296690 19:16417283-16417305 ACCACACAGCTGCCACCCACAGG + Intronic
1163569457 19:18072098-18072120 CCCACACAGGTGCCTCCTCTGGG - Exonic
1164915306 19:32047185-32047207 TCCACACACCTGCCTCAGCTAGG - Intergenic
1165261363 19:34621901-34621923 CCCAGACACTTTCCTCCCAGAGG - Intronic
1165372472 19:35417866-35417888 CTCACACCCCAGCCTCCCAAAGG - Intergenic
1166194807 19:41198609-41198631 CCCACTCACCTGACCCCCCTGGG - Exonic
1166314562 19:41981831-41981853 CCCTCACACATGCCTCCCCCAGG - Exonic
1166568364 19:43778815-43778837 CCCAGACACCTGCTCCCCAGGGG - Intronic
1167103185 19:47416611-47416633 CCCACACCCCCTCCTCCAATGGG - Intronic
925562948 2:5217945-5217967 CCCAAACAGGTCCCTCCCATGGG - Intergenic
925832546 2:7910367-7910389 CCTGCAGCCCTGCCTCCCATGGG - Intergenic
926358402 2:12062542-12062564 CCCACACACCTGCCTCTGCCAGG + Intergenic
927881304 2:26692005-26692027 GCCACACTCCTTCCTCCCTTGGG - Intergenic
927941234 2:27104189-27104211 CCCAGTCTCCTGCCTCCCAGAGG + Intronic
928351963 2:30566004-30566026 CCTACACTCCTTCCGCCCATGGG - Intronic
928812184 2:35241409-35241431 CCCACTCTCCACCCTCCCATAGG - Intergenic
929447074 2:42010125-42010147 CCCACACACCAGGCTGCCTTTGG + Intergenic
930622361 2:53657624-53657646 CCCACCCTCCTTCCTCCAATAGG - Intronic
931487353 2:62706166-62706188 CCCAGACCCCTGCCCCCCAGCGG - Intronic
932439901 2:71727815-71727837 TCCACAAACCTGCTTGCCATTGG + Intergenic
932706666 2:74031282-74031304 CCCACTCACCTGCCCACCCTGGG - Intronic
933063956 2:77771302-77771324 CCCACACACCTACCTCTCCCTGG - Intergenic
934458266 2:94193245-94193267 CCCAGGCACCTGCCTCCCCAGGG + Intergenic
934604376 2:95682886-95682908 CCCCCACGCCTGCTTCCCAGAGG - Intergenic
935027100 2:99287368-99287390 CCCACACTCCACCCTCCAATAGG - Intronic
936039959 2:109142258-109142280 CCCACCCACATCCCTTCCATTGG + Intronic
936375938 2:111941646-111941668 CCCACACCCCACCCTCCCAGTGG + Intronic
936537775 2:113325117-113325139 CCCCCACGCCTGCCTCCCAGAGG - Intergenic
937043353 2:118837414-118837436 CCCACCCACCTGCCTGCCAAAGG + Intergenic
937309597 2:120893917-120893939 CCCACACAATTCCCTCCCCTAGG - Intronic
937544811 2:123004176-123004198 TGCACACAGCTGCCTACCATGGG - Intergenic
939877050 2:147589294-147589316 CCCACACAACAGGCTGCCATGGG + Intergenic
940089090 2:149896137-149896159 CCCACCCTCCAACCTCCCATAGG - Intergenic
942774476 2:179564796-179564818 CCCTCCCACCTGTATCCCATTGG + Intronic
946182904 2:217959753-217959775 CCCACCCAGCTGCTTCCCTTGGG - Intronic
946192827 2:218016442-218016464 CCCACCCACCTCTCTCCCCTTGG + Intergenic
948459483 2:238122243-238122265 ACCACACCCCTGGCTCCCATAGG - Intronic
948547985 2:238746125-238746147 CCCACACACCTGCCCCCGCTGGG + Intergenic
948674810 2:239591081-239591103 CACACACACAACCCTCCCATGGG + Intergenic
948919067 2:241052881-241052903 CCCTCTCACCTGCCTGCCACTGG - Intronic
1168848225 20:959563-959585 CCCACAGGCCTCCCTCTCATGGG - Exonic
1169247587 20:4035663-4035685 CACACACTCCTGCCTCCTAGTGG - Intergenic
1170898037 20:20434230-20434252 CACACACACTGGCCTCTCATGGG + Intronic
1172172506 20:32947821-32947843 TCCTCCCACCTGCCTCCCAAAGG - Intronic
1172619190 20:36308005-36308027 CCAACACTCCAGCCACCCATCGG - Intronic
1173909301 20:46652080-46652102 CCCACCCTCCAGCCTCCCATAGG - Intronic
1175301810 20:57948258-57948280 CCCACACCCCTGATTCCCATGGG + Intergenic
1175338250 20:58210407-58210429 CTCCCCCACCTGCCTCCCAAAGG + Intergenic
1175873310 20:62218416-62218438 CCCACCCAGGTGCCTCCCATGGG + Intronic
1175895773 20:62334973-62334995 ACCACAGCCCTGCCTCCCCTCGG - Intronic
1175907681 20:62389377-62389399 CCCACACACCTGCCATCTCTGGG + Exonic
1176042587 20:63073232-63073254 CACACAGACCTGCCCCCCAAGGG - Intergenic
1176348378 21:5770892-5770914 CCCACCCACCTCCCTCCCGGAGG + Intergenic
1176355192 21:5891476-5891498 CCCACCCACCTCCCTCCCGGAGG + Intergenic
1176429692 21:6568089-6568111 CCTACCCACATGGCTCCCATGGG + Intergenic
1176496449 21:7553563-7553585 CCCACCCACCTCCCTCCCGGAGG - Intergenic
1176542699 21:8168962-8168984 CCCACCCACCTCCCTCCCGGAGG + Intergenic
1176561650 21:8352007-8352029 CCCACCCACCTCCCTCCCGGAGG + Intergenic
1178422510 21:32453447-32453469 CCCAGAAGCCTGCCTCCCAGAGG + Exonic
1179189313 21:39109273-39109295 ACCACACACCTGCATCCCAGGGG - Intergenic
1179275122 21:39885289-39885311 CCCACAGCCCTGGCTCCCCTGGG - Intronic
1179635452 21:42705797-42705819 CCCACATTCCTGCCTGCCCTAGG + Intronic
1179705086 21:43175551-43175573 CCTACCCACATGGCTCCCATGGG + Intergenic
1180439531 22:15351382-15351404 CCCACACACTGACCTCACATAGG + Intergenic
1181357943 22:22313182-22313204 CCCAGGCACCTGCCTCCCCAGGG - Intergenic
1181669074 22:24417576-24417598 CCCAGACACATGCCTTCCCTGGG + Exonic
1181981261 22:26768493-26768515 AGCAACCACCTGCCTCCCATCGG - Intergenic
1182481763 22:30613854-30613876 CCCACACACCTGCCCTCTGTGGG + Intronic
1183076755 22:35432307-35432329 CCCACACACCAGGCCTCCATGGG - Intergenic
1183687520 22:39369749-39369771 CCCACAGCTCTGCCTCCCACAGG - Intronic
1184359645 22:44007262-44007284 CCAGCCCACCTTCCTCCCATAGG - Intronic
1184907113 22:47495807-47495829 CCCCCATTCCTGCCTCCCCTTGG + Intergenic
1185300544 22:50077660-50077682 CACACTCTCCTGCCTCACATGGG + Intronic
1185391008 22:50561921-50561943 CCCTCACACCTGCCACACCTGGG - Intronic
1203247566 22_KI270733v1_random:85205-85227 CCCACCCACCTCCCTCCCGGAGG + Intergenic
949418303 3:3837005-3837027 CCTTCACACCTCCTTCCCATGGG - Intronic
950147720 3:10663783-10663805 CCCAGACACCTTCCTGGCATGGG + Intronic
950261349 3:11545019-11545041 CCCACACAGCTGGCTCCGCTGGG - Intronic
950660106 3:14461896-14461918 CCCAGACACTTACCTCCCAAAGG + Intronic
951742299 3:25937980-25938002 CAAAAACACCTGGCTCCCATTGG - Intergenic
952527065 3:34221838-34221860 CCTAAACATCTGCCTCTCATAGG - Intergenic
953119231 3:40023642-40023664 CTCACACAAATGCCTTCCATTGG + Intronic
953377412 3:42440461-42440483 CCCACCCACCTGTCACCAATAGG + Intergenic
953682858 3:45052632-45052654 CCCATACCCCTTCCTCCCCTGGG + Intergenic
953907958 3:46877830-46877852 CCCACTCACCTGCAGCCCATGGG - Intronic
954149079 3:48648286-48648308 CTCACATACCTGAATCCCATGGG - Exonic
954154901 3:48680023-48680045 CCCACACACATACCCCACATGGG - Intronic
954386774 3:50248279-50248301 CCCTCGCACCTGCCTCTCAGAGG - Intronic
954392563 3:50275242-50275264 ACCCCACGCCTGCCTCCCATCGG - Intronic
954878539 3:53819006-53819028 CCCACACTCGTGCCCCGCATGGG + Exonic
956557379 3:70538739-70538761 CCCAGCCACCTTCCTCCCAGAGG - Intergenic
958961952 3:100519140-100519162 CCCACTCACATGCTTCCCCTGGG - Intronic
960045517 3:113193590-113193612 CCCACCCACCTTCCTCCCTGTGG - Intergenic
960223988 3:115147997-115148019 TCCAGACACCTGCCTCTCACTGG - Intergenic
961572949 3:127813459-127813481 ACCAGACCCCTGTCTCCCATGGG - Intronic
961880085 3:130055763-130055785 CCCAGAAGCCTGCCTCCCAGAGG - Intergenic
963265684 3:143238161-143238183 CCCATAAACATGCCTTCCATGGG + Intergenic
963642836 3:147880087-147880109 CCCAGCCACCTTCCTCCCAGGGG - Intergenic
964209010 3:154208085-154208107 CCCACCCACCATCCTCCAATAGG - Intronic
965701435 3:171462404-171462426 CCCACACCCCTGCCTTCCCCTGG - Intergenic
966362158 3:179141857-179141879 CCCACCCTCCACCCTCCCATAGG - Intergenic
967176711 3:186867166-186867188 CACACACTCCTGCCTCCTAGTGG - Intergenic
968131628 3:196195802-196195824 CTCACCCACCTGCCTGGCATGGG - Intergenic
968949288 4:3682272-3682294 CCCACTCTCCTGCCTCACAATGG - Intergenic
969228579 4:5814700-5814722 GCCACACCCCTGCCCCCCACTGG + Intronic
969491154 4:7499921-7499943 CCCAGCCGCCTGCCTCCCCTGGG - Intronic
971108709 4:23557559-23557581 CTCACATAGCTGACTCCCATTGG + Intergenic
978634295 4:110785490-110785512 CCCAGACACCAGCCTGCCACAGG - Intergenic
979279777 4:118852710-118852732 CCCACCCTCCAGCCTCCAATAGG - Intronic
979441001 4:120749577-120749599 GCCACAGACCTGCCTCACACAGG + Intronic
979690553 4:123554275-123554297 CCCCCTCTCCTGCCTCCCAGTGG - Intergenic
981734894 4:147938204-147938226 CCCACCCTCCACCCTCCCATAGG - Intronic
983189178 4:164736596-164736618 CCCACAAACCGCCCTGCCATAGG + Intergenic
985532268 5:440986-441008 CCCACCCACCTGCCTGCTGTAGG + Intergenic
985958219 5:3280312-3280334 CACACACACACGCCTTCCATTGG - Intergenic
986004919 5:3659505-3659527 ACCACAGACCAGCCTCCCAGAGG - Intergenic
986134772 5:4966063-4966085 CCCCCACCTCTGCCTCCCAAAGG - Intergenic
987124861 5:14802709-14802731 CCCTCCCACCTGCCTCCCCCTGG + Intronic
989085616 5:37673050-37673072 CCCACCCTCCACCCTCCCATAGG + Intronic
990517503 5:56544066-56544088 CACACACACCAGCCTCACTTGGG + Intronic
990823943 5:59875952-59875974 CCCACCCTCCAGCCTCCAATAGG - Intronic
992019463 5:72607628-72607650 AACTCACACCTGCCTCCCAGGGG + Intergenic
993219706 5:85076412-85076434 CCCACACTCCACCCTCCAATAGG + Intergenic
993347063 5:86797492-86797514 CCCACACTCCATCCTCCCATAGG + Intergenic
994293902 5:98065692-98065714 CCCACAGCCCTTCCTCCCAGAGG - Intergenic
995554999 5:113318673-113318695 CCCACCCTCCACCCTCCCATAGG - Intronic
997665568 5:135627247-135627269 CCCACCCTCCAGTCTCCCATTGG - Intergenic
997864210 5:137446528-137446550 CTCACATACCTTCCTCCTATGGG - Intronic
1001930888 5:175672266-175672288 CCCACATCCCTGCCACCCAGGGG - Intronic
1003361972 6:5435641-5435663 ACTACACACTTGCCTCCCACTGG + Intronic
1003548387 6:7080602-7080624 CCCCCAGACCTTCCTTCCATGGG + Intergenic
1004112268 6:12730751-12730773 CCCACCCTCCGGCCTCCAATAGG + Intronic
1005206321 6:23409501-23409523 CCCACACACCTTCCACACAGGGG + Intergenic
1006448343 6:34092167-34092189 CCTACACACCAACCTCCCTTTGG + Intronic
1007368579 6:41411749-41411771 CCCTCTCACCTGCCTTCCCTAGG + Intergenic
1007729104 6:43935032-43935054 CCCACATCCCTGACTCCCCTTGG - Intergenic
1009942295 6:70303409-70303431 TCCACACCTCTGCCTCCCAGTGG - Intergenic
1011993822 6:93559488-93559510 CCCACCCTCCATCCTCCCATAGG + Intergenic
1013002577 6:106038725-106038747 CATACACAGCTGCCTGCCATGGG + Intergenic
1015248069 6:131097535-131097557 CCCACACTCCACCCTCCAATAGG - Intergenic
1015995208 6:138989585-138989607 CCCAGACAGCTGCCTTCCAAAGG + Intergenic
1016019465 6:139220473-139220495 ACCTCACTCCTGCCTCCCTTTGG - Intergenic
1017374172 6:153748277-153748299 CCCATAATCCTGTCTCCCATTGG - Intergenic
1017750307 6:157485324-157485346 CCAACAAAACTGCCTCCCAGGGG - Intronic
1017829557 6:158113838-158113860 CCCACACACCAGACTGCCCTGGG - Intronic
1018564902 6:165141063-165141085 TCCAGACACCAGGCTCCCATTGG + Intergenic
1018633948 6:165844047-165844069 ACCCCACACCTGCCTCCTTTGGG - Intronic
1018763507 6:166910735-166910757 CCCACACACCTGACCTCCCTGGG - Intronic
1020315120 7:6900466-6900488 CCCAGAAGCCTGCCTCCCAGAGG - Intergenic
1020763382 7:12293431-12293453 CCCAGCCACCTTCCTCCCAAAGG + Intergenic
1021852944 7:24826373-24826395 GCCACACCCCTGCCTACCACAGG + Intronic
1022496481 7:30856097-30856119 CCCCCACCTCTGCCTCCCATTGG + Intronic
1023024033 7:36035197-36035219 CCCACACTCCTAGCTCCCAGAGG - Intergenic
1024156380 7:46629791-46629813 GCCACAAACCTGCCTCCCGAGGG - Intergenic
1025176174 7:56803544-56803566 GCCCCACTCCTGCCTCCCAGGGG - Intergenic
1025695619 7:63772878-63772900 GCCCCACTCCTGCCTCCCAGGGG + Intergenic
1025853802 7:65261821-65261843 CACACACTCCTGCCTCCTAGTGG - Intergenic
1025912393 7:65839269-65839291 CCCAAACTCCTGCCTCCCATTGG + Intergenic
1026149270 7:67774207-67774229 GCCACCCACCTACCTCCCAATGG - Intergenic
1027349344 7:77294450-77294472 CACACACACCTACCTCTCATTGG - Intronic
1029110320 7:98210728-98210750 CCCAGAGACCTGTTTCCCATTGG + Intergenic
1029180264 7:98695558-98695580 CTCACACATCCTCCTCCCATTGG + Intergenic
1030675672 7:112383377-112383399 CCCACCCACCTGCCTCTCCCAGG + Intergenic
1032129832 7:129218906-129218928 CCCACAAACCAGGCTCCCCTTGG - Intergenic
1032430143 7:131854368-131854390 CCCTCCCACCTGCCTTCCTTGGG - Intergenic
1032645020 7:133814144-133814166 CCCCCACCCCTGCCTCCTATGGG + Intronic
1033395136 7:140966795-140966817 CCCACAGTCCTGCAACCCATAGG + Intergenic
1033595676 7:142856222-142856244 CCCACACAGCTCCCTCCCACTGG - Intronic
1033600593 7:142885856-142885878 GCCACAGACCTGCCTACCAAGGG + Intergenic
1035863086 8:3051436-3051458 CCCACCCTCCACCCTCCCATAGG - Intronic
1036569763 8:9969959-9969981 CCCACCCTCCTCCCTCCTATAGG - Intergenic
1036604438 8:10293263-10293285 CCCACGCACCTGGCCACCATGGG - Intronic
1040997233 8:53414070-53414092 CGCACACACCTGCAGCCCTTGGG + Intergenic
1041123642 8:54612342-54612364 TCCCCACAGCTGCCTGCCATGGG + Intergenic
1042963386 8:74325985-74326007 CCCATTCACCTGCCTCCAAGAGG + Intronic
1043582615 8:81731990-81732012 CCCACACACCTGCATCCTAGTGG + Intronic
1045353372 8:101362629-101362651 CCCACACACCTGTCCACCCTTGG + Intergenic
1046976379 8:120282953-120282975 CCCTCAGATCTGTCTCCCATTGG + Intronic
1048292328 8:133190691-133190713 CCCACACACCCGCCTGCCTGGGG + Intergenic
1049239530 8:141530124-141530146 CCACCACATCTGCCTCCCCTTGG - Intergenic
1049514232 8:143044941-143044963 CCCACACACCTGCCTGCAACTGG + Intronic
1050003570 9:1103788-1103810 CCCACCCTCCATCCTCCCATAGG + Intergenic
1050576552 9:7002178-7002200 CCACCGCACTTGCCTCCCATGGG + Intronic
1050611691 9:7360506-7360528 TTCACACACCTTCCTCCCTTAGG - Intergenic
1053688776 9:40569050-40569072 CCCAGGCACCTGCCTCCCCAGGG + Intergenic
1054275258 9:63062007-63062029 CCCAGGCACCTGCCTCCCCAGGG - Intergenic
1054300016 9:63369961-63369983 CCCAGGCACCTGCCTCCCCAGGG + Intergenic
1054399571 9:64702924-64702946 CCCAGGCACCTGCCTCCCCAGGG + Intergenic
1054433154 9:65187189-65187211 CCCAGGCACCTGCCTCCCCAGGG + Intergenic
1054497229 9:65834486-65834508 CCCAGGCACCTGCCTCCCCAGGG - Intergenic
1055742121 9:79401595-79401617 CCCACTCACAGGCCTTCCATTGG + Intergenic
1056681304 9:88721386-88721408 CCCAAAATCCTGCCTCCAATGGG + Intergenic
1057291691 9:93810865-93810887 CCCCCAGACCTGTCTCCCCTCGG - Intergenic
1057772963 9:97983815-97983837 CCCACACCGCTGCCTCCCCCCGG - Intronic
1058868511 9:109183049-109183071 CCCCCACACTTGCCTCCCCCTGG + Intronic
1059312980 9:113401203-113401225 CCCGCTCACCTGCCTCCCTAAGG + Exonic
1060043914 9:120325256-120325278 CCCTCACACCTGCCTTCCATGGG + Intergenic
1060887824 9:127168056-127168078 CCTTCACACCTGCCTCACGTGGG - Intronic
1061042110 9:128146251-128146273 GGCACCCACCTGCCTCCCCTCGG - Intergenic
1061201672 9:129141774-129141796 CAGGCACCCCTGCCTCCCATCGG + Intronic
1061327647 9:129873989-129874011 CCCACACACCTGCCTCCCATTGG - Intronic
1061497151 9:130981603-130981625 CCCCCACACCTGTACCCCATGGG - Intergenic
1061989239 9:134149250-134149272 CCCAACCACCGGCCTCCCATGGG + Intronic
1062340522 9:136092054-136092076 CCCCCACACCGGCCTCCCTGAGG - Intronic
1062481437 9:136754334-136754356 CCCCCACACCTGTCACCCATCGG + Intergenic
1062571041 9:137185511-137185533 CCCACAGACCTGCTACCCAGTGG + Intronic
1203463972 Un_GL000220v1:68440-68462 CCCACCCACCTCCCTCCCGGAGG + Intergenic
1189280250 X:39816143-39816165 TCCTCCTACCTGCCTCCCATTGG + Intergenic
1190009100 X:46767881-46767903 CTCCCACAAGTGCCTCCCATTGG + Intergenic
1190940255 X:55033285-55033307 CCCACACACTTTCCTCCATTAGG - Intergenic
1192465578 X:71353167-71353189 CACACACACCTTCCTCCAAAAGG - Intergenic
1193363264 X:80600203-80600225 CCCACACTCCTCCCTCTGATAGG - Intergenic
1193449594 X:81649557-81649579 CCCACTCACATGGCTCCAATGGG - Intergenic
1194337599 X:92666582-92666604 CACACACACTGACCTCCCATGGG - Intergenic
1197136763 X:123069722-123069744 CCCACCCTCCACCCTCCCATAGG - Intergenic
1197720781 X:129743146-129743168 CCCACCCACCTGCCTGCCCCAGG - Intronic
1198100251 X:133416079-133416101 TCCCCAGACCTGCTTCCCATAGG + Intergenic
1199265341 X:145821195-145821217 CCCCCACCCCTGCCCTCCATAGG + Exonic
1199452575 X:147992294-147992316 CCCCCCCACCTCCCTCCCAGAGG + Intronic
1200133209 X:153862574-153862596 CCCCAACTCCAGCCTCCCATGGG + Exonic
1200180098 X:154144788-154144810 CCCACCCTCCCGCCTCCCTTGGG - Intronic
1200185926 X:154183182-154183204 CCCACCCTCCCGCCTCCCTTGGG - Intergenic
1200191578 X:154220320-154220342 CCCACCCTCCCGCCTCCCTTGGG - Intronic
1200197333 X:154258124-154258146 CCCACCCTCCCGCCTCCCTTGGG - Intronic
1200811220 Y:7487260-7487282 CTCACACACTTGCCTCTCCTGGG - Intergenic