ID: 1061327778

View in Genome Browser
Species Human (GRCh38)
Location 9:129874675-129874697
Sequence GTGCACTCCTTGGCAAGGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061327778_1061327789 25 Left 1061327778 9:129874675-129874697 CCCTTCCTTGCCAAGGAGTGCAC 0: 1
1: 0
2: 1
3: 7
4: 147
Right 1061327789 9:129874723-129874745 CTCTCGGTCATCTGCCACCACGG 0: 1
1: 0
2: 1
3: 16
4: 140
1061327778_1061327790 30 Left 1061327778 9:129874675-129874697 CCCTTCCTTGCCAAGGAGTGCAC 0: 1
1: 0
2: 1
3: 7
4: 147
Right 1061327790 9:129874728-129874750 GGTCATCTGCCACCACGGCACGG 0: 1
1: 0
2: 1
3: 7
4: 153
1061327778_1061327784 9 Left 1061327778 9:129874675-129874697 CCCTTCCTTGCCAAGGAGTGCAC 0: 1
1: 0
2: 1
3: 7
4: 147
Right 1061327784 9:129874707-129874729 CACCACCTACGACCTCCTCTCGG 0: 1
1: 0
2: 1
3: 7
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061327778 Original CRISPR GTGCACTCCTTGGCAAGGAA GGG (reversed) Exonic
908306073 1:62818013-62818035 GTGCAGTCATGGGCAAGGATTGG + Intronic
915090329 1:153419640-153419662 ATGCTCTCCTTGTCAAGGCATGG + Exonic
916899018 1:169200729-169200751 GTGATTTCCTTGGGAAGGAATGG - Intronic
917243371 1:172973614-172973636 GTGCTTTCTTTGGCAAGGAAAGG + Intergenic
917495558 1:175537327-175537349 GTCCACACCCGGGCAAGGAAGGG - Intronic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
921157908 1:212452562-212452584 GTGCCCACCTTGGCAGGGAGAGG - Intergenic
1065248820 10:23788341-23788363 GAGAACTCCTTGGCAAATAAAGG - Intronic
1065957344 10:30705326-30705348 GGCTCCTCCTTGGCAAGGAAAGG - Intergenic
1066296340 10:34057074-34057096 GTGATCCCCTTAGCAAGGAAAGG - Intergenic
1069514759 10:69068776-69068798 GTGCACTGCTTGGGAAACAATGG - Intergenic
1069873709 10:71548606-71548628 GTGCCCCCCTTGGCAAGGTTTGG - Intronic
1070326790 10:75395075-75395097 GAGCAGCCCTTGGCAAGGAGTGG + Intergenic
1071973093 10:90928029-90928051 GTCCACTCCCTGACCAGGAAGGG + Intergenic
1073694473 10:105849567-105849589 CTGCTTTCCTTGGCTAGGAAAGG - Intergenic
1074952374 10:118350677-118350699 GTGTACTTCTTGGCCAGGCATGG + Intergenic
1075084380 10:119404802-119404824 GTGCAGTCCTAGGAATGGAAGGG - Intronic
1075544750 10:123346569-123346591 GTTCCTTCCTTGGCAAGGCAAGG + Intergenic
1080862880 11:36165560-36165582 TTGCACTGCTAGGCAAGAAATGG + Intronic
1083837613 11:65282166-65282188 GTGTACTTCTAGGCAAGGATGGG - Intronic
1085512057 11:77093441-77093463 GAGCACTCTCTGGCCAGGAAGGG + Intronic
1085989571 11:81825489-81825511 GTGGAGTCTTTGGCAAGCAAGGG + Intergenic
1087688234 11:101289358-101289380 GTACACTCCTGGGCAAGGCATGG - Intergenic
1095495532 12:42779953-42779975 GTGCACTGCTGGGCAATGCAGGG + Intergenic
1096403955 12:51329334-51329356 GCGTACTCCTAGGCAAGGGAAGG - Intronic
1096572072 12:52529226-52529248 GTGCATTCCTGGGCAAAGGAAGG - Intergenic
1096650655 12:53060534-53060556 GTCCAGTCCAGGGCAAGGAAAGG + Exonic
1100572880 12:95859255-95859277 GGGCACTCCTAGGAAAAGAAAGG - Intronic
1101927657 12:108985982-108986004 CTCCACTCCTTGGCAAGGCTGGG + Intronic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1104065835 12:125305062-125305084 GGGCACTCCTTGTCATGGATTGG + Intronic
1104127406 12:125861403-125861425 GCGCACTCCTAGGCAGGGAGAGG + Intergenic
1105574805 13:21640446-21640468 GGGCTCTCCTGGGCAAGGACAGG - Intergenic
1107374718 13:39789781-39789803 GTACACCCCTGGACAAGGAAGGG - Intronic
1107997568 13:45875961-45875983 GTGCACACCTGGACAAGGGAGGG + Intergenic
1114856240 14:26448160-26448182 GTGCAATACTTGGCAAAGGAGGG - Exonic
1120768150 14:88350576-88350598 GTCCACTCCAAGGCAAGGTAGGG + Intergenic
1122018990 14:98820791-98820813 GTGCTTTCATTGGCAGGGAAGGG + Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1125112484 15:36049369-36049391 GTGCACTCCACTGAAAGGAAGGG + Intergenic
1129823984 15:78622223-78622245 GTGCACTGATTGGCCAGGCAGGG + Intergenic
1132365839 15:101256068-101256090 ATGCATTTCTTGGCAAGGGATGG - Intergenic
1133051718 16:3120688-3120710 TTGCACACATTGGCAAGCAAAGG + Intergenic
1134299158 16:12974236-12974258 GGCCACTCCTTGGCCAGGAGAGG + Intronic
1139547400 16:67656137-67656159 TTGCTCTCCTTGGGGAGGAAGGG + Intronic
1139602015 16:67992892-67992914 GCACACTCCTGGGCAAGGGAGGG - Intronic
1140064694 16:71600986-71601008 GGACAGTCCTTGCCAAGGAACGG - Intergenic
1140522512 16:75593985-75594007 GTGATCTCCATGGGAAGGAAGGG + Intergenic
1141866660 16:86754649-86754671 GTGCACCCCTGGGCAAGTCACGG - Intergenic
1142284296 16:89165482-89165504 GTGCTGTCCTTTGCAAGGACAGG - Intergenic
1143433996 17:6909148-6909170 GTGCACTGGTGGGGAAGGAAAGG + Intronic
1143631281 17:8141833-8141855 GTGCACTCCTGGGTCCGGAAGGG - Exonic
1146305118 17:31724646-31724668 GTGCAGTGCTTGGCCAGGGAGGG + Intergenic
1149034181 17:52115758-52115780 GTGGACCCCTTGGCCAGGAGAGG - Intronic
1150690171 17:67359062-67359084 CTGCACTCATTGGCCAGGCATGG + Intronic
1151551691 17:74826104-74826126 GTGCAATCATTGGGAAGGCAGGG - Intronic
1163844559 19:19630908-19630930 GTGTACTGCTTGGCCAGGCATGG + Intronic
1163884115 19:19950818-19950840 GAGCACTCCTGTCCAAGGAAGGG - Intergenic
1163927525 19:20360275-20360297 GTGCACACCTGGACAAGGGAGGG - Intergenic
1164567725 19:29339840-29339862 GTGCCCTCCTTGCCATGGCAGGG - Intergenic
1167469771 19:49669130-49669152 TCCCACTCCTTGGCAAGGACAGG + Intronic
930393678 2:50793011-50793033 GAGCACTCTTTAGGAAGGAAGGG + Intronic
930999365 2:57762191-57762213 GTGCAGTCCCTGGCATGTAATGG - Intergenic
932027134 2:68145740-68145762 CTGCACTACTGGGCAATGAATGG + Intronic
933390297 2:81658256-81658278 GTGCACACCTGGACAAGGGAGGG + Intergenic
937112646 2:119378449-119378471 GTGGAGTCCTTGGAAAGGACTGG + Intergenic
937342232 2:121098672-121098694 GTGCACCCCTGGGCAAGGTTGGG - Intergenic
938260155 2:129889795-129889817 GTGCACTCTTCTTCAAGGAAGGG - Intergenic
938673617 2:133608477-133608499 GTCCCTTTCTTGGCAAGGAAAGG + Intergenic
943864703 2:192915124-192915146 GTGCACACCTGGACAAGGGAGGG + Intergenic
943911365 2:193572261-193572283 ATGCATTCCTTGGCAAAGATCGG + Intergenic
944180926 2:196892956-196892978 GTGCAGTTCTTGGTTAGGAAGGG - Intronic
944853974 2:203748750-203748772 GTGCAGTGCCTGGCATGGAATGG - Intergenic
945844028 2:214921726-214921748 AAGGCCTCCTTGGCAAGGAATGG - Intergenic
947498186 2:230654049-230654071 GTGCTCGCCTGGGGAAGGAAGGG - Intergenic
948594073 2:239068257-239068279 GGGCACTCTTTGCCCAGGAAGGG - Intronic
1170926233 20:20726925-20726947 GTGCACTCTTTGGCAAGGAGGGG + Intergenic
1179605027 21:42509715-42509737 GTGCACTGACTGGCGAGGAAGGG - Intronic
1184606572 22:45577806-45577828 GGGCCCTCCCTGGCTAGGAACGG + Intronic
1185346047 22:50311287-50311309 GTTCACCCCTTACCAAGGAAAGG + Exonic
953972817 3:47360238-47360260 GTGCAAACCTGGGCAAGGGAGGG + Intergenic
956443878 3:69307132-69307154 GTGCACTCCCCGGCAAGTGACGG - Intronic
959781589 3:110240522-110240544 GTGGTCTCCTTGGCCAAGAAGGG + Intergenic
962370524 3:134817452-134817474 GTGCACTCCTCTGCCAGGACAGG - Intronic
963406513 3:144870432-144870454 GTGAGCTCCTTGGTATGGAATGG + Intergenic
963907376 3:150783771-150783793 GTGCCCTCCTTGGCCTGGAATGG + Intergenic
964320735 3:155494313-155494335 GTGTATTCCTTGGGAAGGAGTGG - Intronic
964463201 3:156960073-156960095 GTCCACACCTAGGCAATGAATGG + Intronic
964824365 3:160809016-160809038 GTGCACTGCCAGGCAGGGAAGGG + Intronic
968183255 3:196612769-196612791 CATAACTCCTTGGCAAGGAAAGG - Intergenic
968284782 3:197502135-197502157 GTCCTCTCCTTGGCCAGGAGGGG - Intergenic
968893357 4:3384643-3384665 GTCCTCTCATTGGCCAGGAAGGG - Intronic
975558620 4:75688999-75689021 AAACACTCCTAGGCAAGGAAAGG + Intronic
976214584 4:82704328-82704350 TTTCACTCATTGGGAAGGAATGG - Intronic
976441881 4:85085405-85085427 GTCTACTCCGTGGCAAGGAATGG - Intergenic
980413701 4:132458024-132458046 CTGCTTCCCTTGGCAAGGAAAGG - Intergenic
981569457 4:146135935-146135957 GGGCATTTTTTGGCAAGGAAAGG + Intergenic
982764554 4:159330022-159330044 GACCACTCCTTCCCAAGGAAAGG + Intronic
982775614 4:159438516-159438538 GTGTACCACATGGCAAGGAATGG - Intergenic
984666687 4:182436725-182436747 GTGCAATTCTTGGCCAGGCATGG + Intronic
986494838 5:8331817-8331839 GGCCACTCCTGAGCAAGGAAAGG - Intergenic
987135434 5:14895569-14895591 TTGCACTACTTGGCAGTGAATGG - Intergenic
988206088 5:28137034-28137056 GCGCACTCCTGGACAAGGGAGGG + Intergenic
992774541 5:80077978-80078000 CGCCACTCCTTGGCAGGGAAGGG - Intronic
993319483 5:86455874-86455896 GAGCACTGATTGGCAAAGAATGG + Intergenic
995401115 5:111742800-111742822 GTGCTCTTATTGGAAAGGAATGG - Intronic
995868957 5:116724410-116724432 GTGCCCTCCTTGCCCAGGAGTGG - Intergenic
996889925 5:128406436-128406458 GTTCTCTACTTAGCAAGGAAAGG - Intronic
997001518 5:129767582-129767604 ATGCAATCCTTGGCAAATAACGG + Intergenic
998552220 5:143088716-143088738 GCGCACACTTTGGCAAGGGAGGG + Intronic
999296043 5:150459976-150459998 CTACACTCCTTGACAAGGCAGGG - Intergenic
999321660 5:150618972-150618994 GTGCCCTCTTTGGCAGAGAAAGG - Intronic
1000122744 5:158212798-158212820 ATTCTCTCCTTGGCAATGAAGGG + Intergenic
1001792037 5:174466110-174466132 CAGCTTTCCTTGGCAAGGAAAGG - Intergenic
1001963697 5:175895587-175895609 TTGCACTCCTTGGCAAGGTGAGG + Intergenic
1003076872 6:2989788-2989810 GTGCTTTCCTTGGGAAAGAACGG + Intronic
1003401414 6:5794223-5794245 GTGCAGTCCTAGGCAAGTGAAGG + Intergenic
1007679173 6:43622627-43622649 GTGCACTGCTTCGCAAGGTGAGG - Exonic
1010186020 6:73144084-73144106 GTGCTCTACTTGGTAAAGAAGGG + Intronic
1010917001 6:81632449-81632471 CTCCAGTCCTTGGAAAGGAAAGG + Intronic
1015467293 6:133560955-133560977 GGGCACTGATTGGAAAGGAATGG - Intergenic
1015739679 6:136440419-136440441 AGGCACTCCTTGCCAAGGAGAGG + Intronic
1019638521 7:2089771-2089793 GTGCACACCTTCTAAAGGAACGG + Intronic
1020459958 7:8418056-8418078 GCGCACACCTGGACAAGGAAGGG - Intergenic
1022220798 7:28311721-28311743 GTGTACTCCTGGGCAAGGTACGG + Intronic
1022977862 7:35575259-35575281 GGGCTCTCCTTGGCAAGTCAAGG - Intergenic
1023798085 7:43810511-43810533 GTGCACACCTGGACAAGGGAGGG - Intergenic
1024134225 7:46390208-46390230 GTGCCATCCTTGGCCAGCAATGG - Intergenic
1025830663 7:65046397-65046419 GAGCACTCTTTGGAAAGGCAGGG + Intergenic
1025917829 7:65880306-65880328 GAGCACTCTTTGGAAAGGCAGGG + Intronic
1026860859 7:73787590-73787612 GTGAAAACCTTGGCAAGTAAGGG - Intergenic
1028478720 7:91280557-91280579 GTGAATTCCCTGGGAAGGAAGGG - Intergenic
1031679247 7:124650899-124650921 GTGCAGTCCTGGGCAAGGCCAGG + Intergenic
1034908162 7:154969532-154969554 GTGCATTCCTGGGCCAGGAGAGG - Intronic
1035078960 7:156200463-156200485 TGGCACTCCTGGGCAAGCAATGG - Intergenic
1036619804 8:10417168-10417190 GTGAACTCATTGGGAGGGAAAGG - Intronic
1036692006 8:10950049-10950071 ATGCATTCCTGGGCCAGGAAGGG - Intronic
1037806743 8:22062122-22062144 CTGCACTCCCTGGAAAGGAGAGG - Intronic
1044061093 8:87636574-87636596 GTGCACACCTGGACAAGGGAGGG - Intergenic
1047334000 8:123919111-123919133 GAGAACTCCTTGGGAAGGAAGGG + Intronic
1049709053 8:144055547-144055569 GTGCCCTCCTAGCTAAGGAAGGG - Intronic
1051209555 9:14727287-14727309 GTTCTCTCCATGGCAAGGACAGG - Intergenic
1054456165 9:65431540-65431562 ACGCACTGCTTGGCAATGAATGG - Intergenic
1057101903 9:92369263-92369285 GTGGTCTCCGTGGGAAGGAATGG + Intronic
1057349193 9:94280643-94280665 GAGCACACCTGGGCAAGGGAGGG + Intronic
1059024758 9:110614625-110614647 GTGCACACCTGGACAAGGGAGGG + Intergenic
1060497073 9:124126701-124126723 GTGGGCTCCTTGCCAAGCAAGGG + Intergenic
1061327778 9:129874675-129874697 GTGCACTCCTTGGCAAGGAAGGG - Exonic
1186086225 X:5993519-5993541 GTGCCCTGCTTGGCAATGTAAGG - Intronic
1186125864 X:6413299-6413321 GTCCCCTCCTTGCTAAGGAAAGG + Intergenic
1187278753 X:17839813-17839835 GTGTCCTCCTTTGCAAGGACTGG - Intronic
1189613920 X:42765305-42765327 TTCCACTCCTTTGCTAGGAATGG + Intergenic
1191890307 X:65932578-65932600 GTGCACACCTGGACAAGGGAGGG + Intergenic
1194058326 X:89164548-89164570 GTGCACACCTGGACAAGGGAGGG + Intergenic
1198844678 X:140898209-140898231 GTGAAAACCTTGGCAAGTAAGGG + Intergenic
1201208633 Y:11656961-11656983 GTGAACTCCTTGGAATTGAATGG + Intergenic