ID: 1061329378

View in Genome Browser
Species Human (GRCh38)
Location 9:129882741-129882763
Sequence ACCTAAGATGTTTACGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061329378_1061329380 -9 Left 1061329378 9:129882741-129882763 CCTCAGACGTAAACATCTTAGGT No data
Right 1061329380 9:129882755-129882777 ATCTTAGGTTGTGACTGGCCTGG No data
1061329378_1061329383 22 Left 1061329378 9:129882741-129882763 CCTCAGACGTAAACATCTTAGGT No data
Right 1061329383 9:129882786-129882808 TAATTTTTTGTTTTTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061329378 Original CRISPR ACCTAAGATGTTTACGTCTG AGG (reversed) Intergenic
No off target data available for this crispr