ID: 1061329934

View in Genome Browser
Species Human (GRCh38)
Location 9:129885945-129885967
Sequence TCCAGCGGGTCAGGAAATAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061329934_1061329946 10 Left 1061329934 9:129885945-129885967 CCGGTATTTCCTGACCCGCTGGA No data
Right 1061329946 9:129885978-129886000 CCACAGGCTTGTGGCCTCCCCGG No data
1061329934_1061329949 25 Left 1061329934 9:129885945-129885967 CCGGTATTTCCTGACCCGCTGGA No data
Right 1061329949 9:129885993-129886015 CTCCCCGGAGCCGGTGAGTCAGG No data
1061329934_1061329940 -6 Left 1061329934 9:129885945-129885967 CCGGTATTTCCTGACCCGCTGGA No data
Right 1061329940 9:129885962-129885984 GCTGGAGGAGCCGGCCCCACAGG No data
1061329934_1061329947 16 Left 1061329934 9:129885945-129885967 CCGGTATTTCCTGACCCGCTGGA No data
Right 1061329947 9:129885984-129886006 GCTTGTGGCCTCCCCGGAGCCGG No data
1061329934_1061329941 1 Left 1061329934 9:129885945-129885967 CCGGTATTTCCTGACCCGCTGGA No data
Right 1061329941 9:129885969-129885991 GAGCCGGCCCCACAGGCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061329934 Original CRISPR TCCAGCGGGTCAGGAAATAC CGG (reversed) Intergenic
No off target data available for this crispr