ID: 1061335360

View in Genome Browser
Species Human (GRCh38)
Location 9:129930386-129930408
Sequence GCATGAACCCCATTGAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061335360_1061335362 9 Left 1061335360 9:129930386-129930408 CCAGTTCTCAATGGGGTTCATGC 0: 1
1: 0
2: 3
3: 16
4: 121
Right 1061335362 9:129930418-129930440 GCATATGAACCACTGACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061335360 Original CRISPR GCATGAACCCCATTGAGAAC TGG (reversed) Intronic
901202111 1:7472873-7472895 GAGTGAACCCCATGGTGAACTGG - Intronic
903461294 1:23522743-23522765 ACATCAACCTCATTGAGAAAGGG - Intronic
905222670 1:36459642-36459664 ACTAAAACCCCATTGAGAACTGG - Intronic
905969857 1:42133407-42133429 GCAGGATCCCCATTTAGAAGAGG - Intergenic
906435674 1:45794431-45794453 GCACAAACCCTATTGTGAACTGG + Intronic
906706550 1:47899300-47899322 GCATGAGCACCTTAGAGAACAGG - Intronic
910243677 1:85115772-85115794 GCGTGAACACTATTGTGAACTGG - Intronic
915456436 1:156043921-156043943 GTATGAACCCCATTCAGTCCTGG + Intronic
919559178 1:199096364-199096386 GGATGAACCCCCTTCAGGACAGG + Intergenic
923197695 1:231684091-231684113 CCATGAGCTCCATTGAGGACAGG + Intronic
924666656 1:246080352-246080374 GCGTGAACCCTATTGTGAACTGG + Intronic
1063093297 10:2886983-2887005 GCATGAACTGTGTTGAGAACTGG + Intergenic
1063460860 10:6214248-6214270 GAGTGAACCCTATTGTGAACTGG + Intronic
1064956921 10:20921556-20921578 GGCTGAAGCCCATGGAGAACTGG - Intronic
1066476413 10:35751321-35751343 GCAAGAAACCCAAAGAGAACAGG - Intergenic
1067733059 10:48827455-48827477 GCATGAACCACATTCAGATTTGG - Intronic
1071195368 10:83153315-83153337 CCATGAACCTAAGTGAGAACGGG + Intergenic
1072842606 10:98791959-98791981 GCATGGAAACTATTGAGAACGGG - Intronic
1074535066 10:114323009-114323031 GCATGGTCCAAATTGAGAACTGG - Intronic
1074676464 10:115856828-115856850 GCCTGTAGCCTATTGAGAACCGG - Intronic
1076040651 10:127245240-127245262 GCATGAACTCCATTAGGAAACGG - Intronic
1077044115 11:536943-536965 GCATGAACGCGAGTGAGAAGCGG + Intronic
1080395549 11:31886590-31886612 GCGTAAACCCCATTGTGAACTGG + Intronic
1085013155 11:73155321-73155343 GCATGAAGCCCATGGTGATCTGG - Intergenic
1085426969 11:76413344-76413366 ACATGATCGCCATTGACAACTGG + Intronic
1085566375 11:77517869-77517891 GCGTGAACCCTATTGTGAAGTGG - Intronic
1086328223 11:85726432-85726454 GGATGAACCCAATGCAGAACAGG - Intronic
1086756197 11:90565791-90565813 GGCTGAAGCCCATTGAAAACTGG - Intergenic
1087396669 11:97609426-97609448 ACATGAACCTAAATGAGAACAGG - Intergenic
1089787037 11:120915146-120915168 GCATGCAACCCACTGAGACCTGG + Intronic
1090332882 11:125945013-125945035 TCCTGAACCCCAGTGAGAAGGGG - Intergenic
1096914324 12:55015289-55015311 GCATGAAATACATTGAGATCAGG - Intergenic
1097994961 12:65878143-65878165 CTATGAACCCCATTTTGAACTGG + Intronic
1098172714 12:67762923-67762945 GCACAAACCCTATTGTGAACTGG + Intergenic
1110661771 13:78065861-78065883 CCATGAACCTAATTGAGAACAGG + Intergenic
1111488617 13:88938870-88938892 TCATGAGACCCATTAAGAACTGG + Intergenic
1111740515 13:92199119-92199141 GCATGAGGCCCATTTAGAATTGG + Intronic
1111826568 13:93275637-93275659 GGAGAAACCCCATTGAGGACAGG - Intronic
1111827053 13:93280874-93280896 GCACGAACCCTGTTGTGAACCGG - Intronic
1114613164 14:24055146-24055168 GCAGGGACCCCATAGGGAACAGG + Intronic
1116140148 14:40982880-40982902 GCATGAACCATATTAAGAAAAGG - Intergenic
1119067714 14:71546975-71546997 GCATGAAAACAATTGAGAAGAGG - Intronic
1121027311 14:90626066-90626088 GCATGAATCCCCTTGTGATCTGG - Intronic
1128818405 15:70630612-70630634 GCATGGACCCTAGTAAGAACTGG - Intergenic
1130893319 15:88151416-88151438 GCATTAACCCCATAATGAACAGG + Intronic
1134200143 16:12191154-12191176 GCACGAACCCTATTGTGAACTGG - Intronic
1135165729 16:20137696-20137718 TCATGGACCCCAAGGAGAACTGG + Intergenic
1140489781 16:75325412-75325434 GCATAAGCCTCATTGAGAAATGG - Intronic
1141119963 16:81345942-81345964 GCACGAACCCTATTGTGAACTGG - Intronic
1142664203 17:1452874-1452896 GCATGAAGTCTATTGAGATCAGG + Intronic
1143083924 17:4401735-4401757 GCACAAACCCTATTGTGAACCGG + Intergenic
1143384752 17:6522320-6522342 GAATTAACACCCTTGAGAACTGG + Intronic
1146399830 17:32493924-32493946 TCAGGAACCCTAATGAGAACGGG - Exonic
1152410056 17:80118569-80118591 GCAGGAACACCCATGAGAACAGG - Intergenic
1155817399 18:30330768-30330790 GCATGGACCACATTCAGAAAAGG + Intergenic
1160158675 18:76453611-76453633 GCAAGAACCCAATTTAGAAGTGG + Intronic
1160392968 18:78548505-78548527 GCCCGAACCCCATTGAGCACAGG + Intergenic
1160510886 18:79452686-79452708 GCCTGAACCCCCTTGAGGGCTGG - Intronic
1160572212 18:79825993-79826015 GCATGACCCCCATAGAGACGTGG + Intergenic
1168173472 19:54606707-54606729 TCATGAACCCCATTTATCACAGG - Intronic
925033018 2:666107-666129 GCATCAACCCCATGCACAACAGG + Intergenic
926383671 2:12315444-12315466 GCATGAAGCCCCTTGATAAGAGG - Intergenic
929471770 2:42200927-42200949 GCAGGCAGCCCATGGAGAACAGG - Intronic
934159000 2:89230388-89230410 CAAGGAACCCCATTGTGAACAGG - Intergenic
934208274 2:89952037-89952059 CAAGGAACCCCATTGTGAACAGG + Intergenic
934897923 2:98134583-98134605 GAATAAACCCCACTGAGAAAAGG + Intronic
935582289 2:104766994-104767016 CCGTGAACCCAACTGAGAACTGG - Intergenic
937756818 2:125549547-125549569 GAAGCACCCCCATTGAGAACTGG + Intergenic
940430119 2:153579773-153579795 GCATGAACTCTATTGTGAACTGG + Intergenic
944333825 2:198504872-198504894 ACATCAACCCCATTAAAAACTGG + Intronic
948427831 2:237899031-237899053 GCATGCACCCCATTTAGGACTGG - Intronic
1168969815 20:1923352-1923374 GCATCAGCCACATTGATAACAGG - Intronic
1170830732 20:19838597-19838619 GCATGAATCCCAGTGATAAAGGG - Intergenic
1173454575 20:43191948-43191970 ACATGAACCCCATTCAGACCTGG - Intergenic
1173616927 20:44409253-44409275 GGCTTAACCCCATTGAAAACTGG - Intronic
1174160877 20:48549566-48549588 GAATGAACTGCATGGAGAACAGG - Intergenic
1176244296 20:64090064-64090086 GCATGGACACCTTTGGGAACAGG - Intronic
1177885972 21:26746585-26746607 GCATGAAGCCTCTTGAGGACAGG - Intergenic
1179072252 21:38082757-38082779 GCATGAGCTCAATTGAGAAAGGG + Intronic
1180835886 22:18929214-18929236 GCATGCACCCCTGTGAGGACAGG + Intronic
1183321749 22:37169217-37169239 GCAAGAACCCCTCTGAAAACAGG - Intronic
1184597238 22:45521566-45521588 GTTTGGACCCCAGTGAGAACAGG - Intronic
1203285977 22_KI270734v1_random:154513-154535 GCATGCACCCCTGTGAGGACAGG + Intergenic
950729170 3:14941835-14941857 GCATGAACCTCTTTGAGAATCGG - Intergenic
951122539 3:18945334-18945356 TCCTGAACCCCATTCAAAACTGG - Intergenic
953398197 3:42589644-42589666 GCGTGAACCCTATTGTGAACTGG + Intronic
954445526 3:50544564-50544586 CCAAGAATCCCATTGAGAAATGG + Intergenic
955922804 3:63975227-63975249 GCATGATACCCGTTGAGAATGGG + Intronic
961315696 3:126033872-126033894 GCACAGACCCCTTTGAGAACTGG + Intronic
962052114 3:131827166-131827188 GCATAAAAGCAATTGAGAACTGG - Intronic
962953935 3:140247078-140247100 GGATGAACACCATTGAGAGATGG + Intronic
967602789 3:191409484-191409506 GCATGAACCCTATTGCGAACTGG + Intergenic
968386143 4:140175-140197 CCATGAACTGCAATGAGAACTGG - Intronic
973134424 4:46689053-46689075 TCCTGAAACACATTGAGAACTGG + Intergenic
975179125 4:71323358-71323380 GCAAGAAACTCATTTAGAACTGG + Intronic
977119042 4:93073671-93073693 GCATGTACCCCATAGATAAGAGG - Intronic
980554574 4:134386790-134386812 CCATGACCCTCAGTGAGAACAGG + Intergenic
980731693 4:136832345-136832367 CCATGAACCTAAGTGAGAACAGG - Intergenic
980937647 4:139241579-139241601 CCATGAACTCTAATGAGAACAGG + Intergenic
983612589 4:169665883-169665905 GGATAAACCCCTTTGAGAAAAGG + Intronic
985663607 5:1169804-1169826 GCATCAGCCCCAATGAGGACAGG + Intergenic
987645564 5:20667726-20667748 GCATGAACCCTATTGTGAACTGG - Intergenic
989215592 5:38901472-38901494 GCATGAACCCAAGTAAGAATGGG + Intronic
991719433 5:69481604-69481626 TCATGAACCCTATGGTGAACTGG - Intergenic
993280463 5:85919614-85919636 CCATGAACCTAAGTGAGAACAGG - Intergenic
994503757 5:100613591-100613613 GCATGAGCCCTATTGTGAACTGG + Intergenic
995665554 5:114537984-114538006 TCATGGACTCCTTTGAGAACTGG + Intergenic
995905782 5:117120853-117120875 GCACAAACCCTATTGTGAACAGG + Intergenic
1001996988 5:176170067-176170089 GCATCACCTCCATTGAGGACAGG - Intergenic
1003634598 6:7820904-7820926 GCACAAACCCTATTGTGAACCGG - Intronic
1007346396 6:41232755-41232777 GCATGAACCCTATTATGAATGGG - Intronic
1007627796 6:43256049-43256071 GCATGAAAAGCACTGAGAACAGG - Intronic
1015743472 6:136484193-136484215 GCTTGAGCCCTATTAAGAACTGG + Intronic
1016441121 6:144084638-144084660 GCTTGAACCCTATTGTGAACTGG + Intergenic
1018662298 6:166099401-166099423 GCACGAACCCTATTGTGAACTGG - Intergenic
1020997114 7:15278899-15278921 GCATGGACCCCATTTAGCAGTGG + Intronic
1023887993 7:44374636-44374658 ACACGCACCCCTTTGAGAACAGG + Intergenic
1026039968 7:66859942-66859964 GCATGACTCCCACTGAGAGCTGG - Intergenic
1026171208 7:67955379-67955401 GGAGGAAGCCCATTGAGAGCTGG + Intergenic
1028795044 7:94893360-94893382 GCATGAACCCTAATAAAAACAGG + Intergenic
1032063694 7:128747307-128747329 CCATGAAACCCATAGAGAAATGG - Intronic
1034485489 7:151358511-151358533 GCATGAACCCTATTGTGAACTGG + Intronic
1036170176 8:6475936-6475958 GGATCAACCCCATTGAGGACTGG + Intronic
1041571927 8:59346942-59346964 GCAGGAACCACATTGGGAGCAGG + Intergenic
1042740959 8:72045925-72045947 GAATGAACCCCATTGGAAGCAGG - Intronic
1043204632 8:77421820-77421842 GCAGGAACCCTATTGTGAACTGG + Intergenic
1046730539 8:117720940-117720962 GGATGTAGCCCATTGAAAACAGG + Intergenic
1047300487 8:123609634-123609656 GCATCAACCACATTCAGAGCTGG - Intergenic
1052324055 9:27197988-27198010 GCTTGAAACCCCTTGAAAACAGG + Intronic
1052538043 9:29772980-29773002 ACATGAACTCCATAGAGAATGGG - Intergenic
1058620152 9:106874323-106874345 TGAAGAAACCCATTGAGAACTGG - Intronic
1058715490 9:107718817-107718839 GCATGGACCCCACTGAGGGCAGG - Intergenic
1060767381 9:126305014-126305036 GCATGGAAACCACTGAGAACGGG - Intergenic
1061335360 9:129930386-129930408 GCATGAACCCCATTGAGAACTGG - Intronic
1062584742 9:137244174-137244196 GGATGAACCCCATGTAGAAGGGG + Exonic
1186854259 X:13610805-13610827 CCATAAACCCCATTTTGAACAGG - Intronic
1186894405 X:13991558-13991580 GCATCAAACCCATTGAGAGGAGG - Intergenic
1186897155 X:14015049-14015071 GCTTAAACCCCATTGGGAAGAGG - Intronic
1190600770 X:52089683-52089705 CCATGAACCTAAGTGAGAACTGG + Intergenic
1190767776 X:53489628-53489650 CCATGAACCCCACTGAAACCAGG + Intergenic
1197642578 X:128983346-128983368 CAATGAACCCCATTAAAAACTGG + Intergenic