ID: 1061344862

View in Genome Browser
Species Human (GRCh38)
Location 9:130015353-130015375
Sequence GTTCATATACAGAGACCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061344862_1061344863 8 Left 1061344862 9:130015353-130015375 CCAATAGGTCTCTGTATATGAAC 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1061344863 9:130015384-130015406 GTGTCTTGATACCTTCTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061344862 Original CRISPR GTTCATATACAGAGACCTAT TGG (reversed) Intronic
905095109 1:35463481-35463503 GTTCACATACAGTGAGCTCTAGG - Intronic
905499263 1:38423649-38423671 TTTCATAAAAATAGACCTATTGG - Intergenic
907025774 1:51116786-51116808 TATCATATACAAAGACCTACTGG - Intronic
912343165 1:108937369-108937391 GTTCATGTGCTGAGACATATAGG - Exonic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
915951362 1:160191769-160191791 GTTCATACACACACACCTTTAGG + Intronic
916294925 1:163207936-163207958 GTTCATAGAGAGTGACATATAGG + Intronic
917688152 1:177439193-177439215 TTTCATATACACAGACTAATTGG + Intergenic
918026322 1:180751963-180751985 GTTCATATCCCCAGACTTATGGG - Intronic
919357407 1:196541492-196541514 GTCCATATACAAAGTCTTATTGG + Intronic
920385247 1:205566891-205566913 CTTCATAGTCAAAGACCTATTGG - Intergenic
921988283 1:221336013-221336035 GTTCATAGGCTGAGACCTAGGGG + Intergenic
1064371153 10:14752454-14752476 GTCCAGATACAAAGACATATAGG + Intronic
1068659995 10:59613817-59613839 TTTCATATACATAACCCTATTGG + Intergenic
1070456600 10:76623380-76623402 GTTCATTTCCACAAACCTATAGG + Intergenic
1071127412 10:82351291-82351313 GTTCATATAAAGACACATTTGGG + Intronic
1074233400 10:111560520-111560542 ATTCATGTACAGAGACCCAAAGG + Intergenic
1077749491 11:4949562-4949584 GTTCCTATACAGAAAATTATAGG + Intronic
1078606373 11:12779719-12779741 GTTAATATACAGTGACCAAGTGG + Intronic
1078999150 11:16736338-16736360 TTTCATATACAGAAGGCTATAGG - Intronic
1088197453 11:107291265-107291287 TTTCATATACAGAGAGAGATAGG + Intergenic
1088689421 11:112312465-112312487 TTTCATATAAACAGAACTATGGG + Intergenic
1091453820 12:590496-590518 GTTCATCAACTGAGTCCTATTGG - Intronic
1092658840 12:10717065-10717087 GTTCAGATACAGTGACTTTTAGG - Intronic
1098928173 12:76376938-76376960 CATCATACACTGAGACCTATTGG - Intronic
1099708347 12:86186423-86186445 TTTCAGATTCAGAAACCTATGGG + Intronic
1100714731 12:97293836-97293858 ATTCATGTAAATAGACCTATGGG - Intergenic
1101245753 12:102883131-102883153 TTTCATATTCAGAGACCTGTGGG + Intronic
1103100822 12:118173904-118173926 GTTGATTTACAGAGACTTCTTGG - Intronic
1104317055 12:127712910-127712932 GTACATATACACACACATATAGG + Intergenic
1107696924 13:43009395-43009417 GTCCAAATACAGAGCCTTATTGG - Intergenic
1109783152 13:67139759-67139781 GTTCATATGCAGAGTCAGATTGG - Intronic
1115226695 14:31110497-31110519 ATTTATATACATAGAACTATAGG - Intronic
1119509672 14:75200853-75200875 TTTCATGTACACAGACATATAGG + Intergenic
1124578304 15:30928345-30928367 GTTTATATACAGAGCCTTAAGGG - Intronic
1126960648 15:53990457-53990479 CTTCATATACAGATACAAATAGG - Intergenic
1127051687 15:55090315-55090337 GTTTTGATTCAGAGACCTATGGG + Intergenic
1128424553 15:67527316-67527338 GTACATATCCATAGACTTATTGG + Exonic
1133958275 16:10466744-10466766 GTTCATATAAAGACACCATTAGG - Intronic
1135806040 16:25543559-25543581 GTTCATTTACATACCCCTATAGG + Intergenic
1141760826 16:86027365-86027387 GTTCACATACAGAGGCCCAGCGG - Intergenic
1144326411 17:14186259-14186281 GGCCACATACAGAGACCTCTGGG - Intronic
1144475289 17:15583134-15583156 GGCCACATACAGAGACCTCTGGG - Intronic
1157137844 18:45074746-45074768 ATTCATATACAAGGACTTATGGG + Intergenic
926025584 2:9541232-9541254 ATACACACACAGAGACCTATAGG + Intronic
927578725 2:24222602-24222624 GTGCATATTCAGAGAACTAAAGG - Intronic
928578849 2:32684515-32684537 TTTCATTTACAGAGACCTAGGGG - Intronic
928859775 2:35843592-35843614 GTGTATATATAGAGATCTATGGG + Intergenic
928910279 2:36414022-36414044 GCTCATACACAGAAACCTATTGG - Intronic
931681906 2:64757426-64757448 GTTCATATACAGACCCATAAGGG - Intergenic
937134647 2:119542361-119542383 CTTCTTATACAGAGACCTATGGG + Intergenic
939855931 2:147358609-147358631 GTTCATATAAAGTGAGCCATTGG - Intergenic
940207439 2:151219303-151219325 TTTCAAATACAGAGTTCTATGGG + Intergenic
940319752 2:152364341-152364363 TTTTATTTACAGAGACCTATAGG + Intronic
943345284 2:186731671-186731693 ATACAGATACTGAGACCTATCGG + Intronic
946896825 2:224332525-224332547 CTACATATCCAGAGGCCTATAGG + Intergenic
1174615336 20:51831153-51831175 GTTCATTTACAGAGGCATAGAGG + Intergenic
957292839 3:78299124-78299146 GGTGATGTACAGAGAACTATGGG - Intergenic
957763206 3:84586850-84586872 GTACATAAACAGAGACATAGAGG - Intergenic
959000082 3:100954051-100954073 GTCCAGATACAGTGACCTCTAGG + Intronic
959831497 3:110868501-110868523 GTTCAAAGACAGATGCCTATGGG + Intergenic
960076128 3:113487408-113487430 GTTCATATACATATGACTATAGG + Intronic
960390778 3:117075323-117075345 GTTGGTTTTCAGAGACCTATAGG + Intronic
961222314 3:125211096-125211118 GTTCATATACAGAAAACCTTTGG - Intronic
962412845 3:135156359-135156381 GAACAGAAACAGAGACCTATGGG + Intronic
966012794 3:175102165-175102187 TTTCTTATACAGGGACCTTTAGG + Intronic
966231614 3:177658639-177658661 GTTCATTTACAAAGACCCAAGGG + Intergenic
970683722 4:18540895-18540917 GTTCATACACAAAGACCAAATGG - Intergenic
972136837 4:35903423-35903445 GTGCCTGTACAGAGAACTATAGG - Intergenic
973979232 4:56292907-56292929 GATAATAGACAGAGACCTAAAGG + Intronic
974129253 4:57732480-57732502 GTTCAAATACTGAGACCCTTGGG - Intergenic
979047995 4:115894230-115894252 ATTTATATACAGAGAAATATGGG + Intergenic
981267350 4:142802473-142802495 GTTCACAAACACAGACCTCTGGG - Intronic
981748526 4:148072737-148072759 TTTCATTTACAGAGACCTTGAGG - Exonic
983389866 4:167116170-167116192 GTACACATACAGATACCTCTTGG - Intronic
986377393 5:7146349-7146371 GTTCATGTACACAGAAGTATGGG + Intergenic
988025656 5:25685487-25685509 GTGCATATACAGACACCTGCAGG + Intergenic
990606267 5:57413508-57413530 TTACATCTACACAGACCTATTGG - Intergenic
993039780 5:82800963-82800985 GTTCATAGACAGAGACAAAGAGG - Intergenic
993047863 5:82888806-82888828 GTTCTTATGCTGAGTCCTATGGG - Intergenic
995022316 5:107380687-107380709 GTTCATTTACATACTCCTATAGG + Exonic
995166233 5:109045537-109045559 GTTCATGTTTAGAGTCCTATAGG + Intronic
997430882 5:133840303-133840325 GTGCATATGCACAGCCCTATTGG + Intergenic
1003330996 6:5128728-5128750 GTTCATATCCAGAGTCCTGTGGG - Intronic
1004573961 6:16874554-16874576 GCTCTTATACAGAGACCCATGGG - Intergenic
1005594195 6:27363206-27363228 GTCCATATACAGAAACATGTTGG - Intergenic
1007563361 6:42829096-42829118 GTTCATAGACAGACTCCTAATGG + Exonic
1008180570 6:48322925-48322947 GTTCTTATCCAAAGAACTATGGG - Intergenic
1009473712 6:64061368-64061390 GATCACATAGAGAGAGCTATTGG - Intronic
1009586502 6:65613036-65613058 TTTCATTTACAGAGACTTCTGGG - Intronic
1012166241 6:95956219-95956241 GTTCATATATGGAGACTTCTGGG + Intergenic
1015851535 6:137578642-137578664 TTTCATATACATACACATATAGG - Intergenic
1016951182 6:149581714-149581736 CTTAATATACAGAGAGATATCGG - Intronic
1016966920 6:149727050-149727072 GTTCACAGACAGAGACCTACTGG + Exonic
1024855820 7:53778112-53778134 GTTGATATAGGGAGACTTATAGG - Intergenic
1028481169 7:91306981-91307003 TTTCAGATACAGAGGGCTATGGG - Intergenic
1033645171 7:143296215-143296237 ATGCATATTCAGTGACCTATTGG + Intronic
1041011511 8:53548162-53548184 GGTCACACACAGAGTCCTATGGG - Intergenic
1043527137 8:81109710-81109732 GTTCATAGACATAGAGCTGTTGG - Intronic
1046368925 8:113274546-113274568 GTGCAATTACAGATACCTATTGG + Intronic
1047914845 8:129571979-129572001 GTTCACATAAAGGGGCCTATTGG + Intergenic
1054731123 9:68704243-68704265 GTTCATTTGCAGAGAACTAAGGG + Intergenic
1061344862 9:130015353-130015375 GTTCATATACAGAGACCTATTGG - Intronic
1189530130 X:41871795-41871817 GTTCAGATACATAGACCTTGGGG + Intronic
1192571747 X:72211936-72211958 CTTCTTATAGAGAGACCTTTAGG - Intronic
1192947620 X:75983156-75983178 GTTGAAACACAGAGGCCTATGGG + Intergenic
1194760863 X:97794737-97794759 TTACATATTCAGAGACCTCTTGG + Intergenic
1197586907 X:128359590-128359612 GTTAATATACAAAAACATATAGG - Intergenic
1202180299 Y:22134092-22134114 TTTCATATTCAGAGACAAATGGG - Intergenic
1202211061 Y:22452307-22452329 TTTCATATTCAGAGACAAATGGG + Intergenic