ID: 1061346865

View in Genome Browser
Species Human (GRCh38)
Location 9:130033428-130033450
Sequence CTGTGCAAATAGAAGTACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061346863_1061346865 -7 Left 1061346863 9:130033412-130033434 CCGTTCTCAATTTTGGCTGTGCA 0: 1
1: 0
2: 1
3: 20
4: 203
Right 1061346865 9:130033428-130033450 CTGTGCAAATAGAAGTACAAGGG No data
1061346857_1061346865 30 Left 1061346857 9:130033375-130033397 CCAGAGCCTGTCTGGTCTTTAAA 0: 1
1: 0
2: 0
3: 14
4: 140
Right 1061346865 9:130033428-130033450 CTGTGCAAATAGAAGTACAAGGG No data
1061346859_1061346865 24 Left 1061346859 9:130033381-130033403 CCTGTCTGGTCTTTAAATGGATT 0: 1
1: 0
2: 1
3: 11
4: 232
Right 1061346865 9:130033428-130033450 CTGTGCAAATAGAAGTACAAGGG No data
1061346862_1061346865 -6 Left 1061346862 9:130033411-130033433 CCCGTTCTCAATTTTGGCTGTGC 0: 1
1: 0
2: 3
3: 29
4: 822
Right 1061346865 9:130033428-130033450 CTGTGCAAATAGAAGTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061346865 Original CRISPR CTGTGCAAATAGAAGTACAA GGG Intronic
No off target data available for this crispr