ID: 1061347268

View in Genome Browser
Species Human (GRCh38)
Location 9:130036747-130036769
Sequence AAGAAAAAGGAGCAGTAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061347258_1061347268 27 Left 1061347258 9:130036697-130036719 CCCCTGTTGGTCTTGCCATGTTC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG No data
1061347263_1061347268 2 Left 1061347263 9:130036722-130036744 CCCAAACAGAAATCTCTGAAGGG 0: 1
1: 0
2: 6
3: 17
4: 253
Right 1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG No data
1061347261_1061347268 12 Left 1061347261 9:130036712-130036734 CCATGTTCATCCCAAACAGAAAT 0: 1
1: 0
2: 1
3: 15
4: 287
Right 1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG No data
1061347265_1061347268 1 Left 1061347265 9:130036723-130036745 CCAAACAGAAATCTCTGAAGGGT 0: 1
1: 0
2: 4
3: 18
4: 229
Right 1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG No data
1061347260_1061347268 25 Left 1061347260 9:130036699-130036721 CCTGTTGGTCTTGCCATGTTCAT 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG No data
1061347259_1061347268 26 Left 1061347259 9:130036698-130036720 CCCTGTTGGTCTTGCCATGTTCA 0: 1
1: 0
2: 0
3: 8
4: 142
Right 1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061347268 Original CRISPR AAGAAAAAGGAGCAGTAGGC CGG Intronic
No off target data available for this crispr