ID: 1061349589

View in Genome Browser
Species Human (GRCh38)
Location 9:130053961-130053983
Sequence CAGCCTAGGACCGCGGGAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061349589_1061349605 26 Left 1061349589 9:130053961-130053983 CCGCCTCCCGCGGTCCTAGGCTG 0: 1
1: 0
2: 0
3: 17
4: 120
Right 1061349605 9:130054010-130054032 GCTGGGTTTGCTGCAGTTGCTGG 0: 1
1: 0
2: 3
3: 22
4: 270
1061349589_1061349601 9 Left 1061349589 9:130053961-130053983 CCGCCTCCCGCGGTCCTAGGCTG 0: 1
1: 0
2: 0
3: 17
4: 120
Right 1061349601 9:130053993-130054015 CTCCGGCTGCTCCCAATGCTGGG 0: 1
1: 0
2: 0
3: 21
4: 230
1061349589_1061349597 -8 Left 1061349589 9:130053961-130053983 CCGCCTCCCGCGGTCCTAGGCTG 0: 1
1: 0
2: 0
3: 17
4: 120
Right 1061349597 9:130053976-130053998 CTAGGCTGGCCGCGGGCCTCCGG 0: 1
1: 0
2: 2
3: 14
4: 149
1061349589_1061349600 8 Left 1061349589 9:130053961-130053983 CCGCCTCCCGCGGTCCTAGGCTG 0: 1
1: 0
2: 0
3: 17
4: 120
Right 1061349600 9:130053992-130054014 CCTCCGGCTGCTCCCAATGCTGG 0: 1
1: 0
2: 2
3: 45
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061349589 Original CRISPR CAGCCTAGGACCGCGGGAGG CGG (reversed) Exonic
900372326 1:2337487-2337509 CACCCTGGGACCCCGGGAGAGGG - Intronic
904461862 1:30685403-30685425 AAGCCCAGGGCCGGGGGAGGGGG - Intergenic
907767192 1:57423521-57423543 GAGCCCAGGACAGCGGGAGAAGG + Intronic
908195353 1:61742355-61742377 GAGCCCGGGGCCGCGGGAGGCGG - Intergenic
908628486 1:66074639-66074661 CAGCCAAGGACTGGGGGAGGGGG - Intronic
914813467 1:151046632-151046654 CAGCCTAGGAGAGGGAGAGGGGG - Exonic
915497385 1:156291688-156291710 AGGCCTAGGACCGCGGTGGGTGG + Exonic
924101887 1:240612091-240612113 CAGCCTGGGACCGCGCGGCGCGG - Exonic
1063196404 10:3747588-3747610 ATACCTAGGACCACGGGAGGAGG - Intergenic
1067431851 10:46250478-46250500 CAGCCTGGAACTGTGGGAGGAGG - Intergenic
1067441570 10:46311700-46311722 CAGCATGGGACTGTGGGAGGAGG + Intronic
1067578267 10:47421160-47421182 CAGGCTGGGACTGTGGGAGGAGG + Intergenic
1069034232 10:63630562-63630584 CAACCTAGGTCCCCGGGAGGTGG + Intergenic
1069634935 10:69919255-69919277 CAGGCCAGGACCCAGGGAGGGGG - Intronic
1070570654 10:77637754-77637776 CCGCCGCGGAGCGCGGGAGGGGG + Intronic
1071181469 10:82989159-82989181 CAACCTAGGAACGCAGTAGGAGG + Intergenic
1071507760 10:86242958-86242980 CAGCGTAGGCCTGCTGGAGGTGG - Intronic
1075060943 10:119256301-119256323 CAGCCTGGGAGCTTGGGAGGGGG + Intronic
1076880611 10:133237596-133237618 CAGCCTCGGCCCGCGGGGTGGGG + Exonic
1077019238 11:410219-410241 CAGCCCAGGACCACGGGGAGGGG + Intronic
1077184145 11:1228908-1228930 CACCCCAGGACCCCAGGAGGGGG + Intronic
1079076781 11:17389303-17389325 GGGTCTAGGACGGCGGGAGGGGG + Intronic
1081598189 11:44473648-44473670 GAGGCTAGGCCCTCGGGAGGTGG + Intergenic
1083611801 11:64007886-64007908 CAGCCTCGGCCCTCTGGAGGCGG - Intronic
1084161706 11:67353699-67353721 CAGCTGTGGGCCGCGGGAGGAGG + Intronic
1085518050 11:77122734-77122756 CAGGCTAGGAGCCCAGGAGGTGG - Intronic
1089165295 11:116471314-116471336 CAGCCTAGGAGATGGGGAGGAGG + Intergenic
1090458436 11:126869229-126869251 CAGCCAATGACAGAGGGAGGTGG + Intronic
1091278893 11:134370757-134370779 CAGCCTCAGTCCGCCGGAGGAGG - Intronic
1102679931 12:114684538-114684560 CAGCCGGGGATCGAGGGAGGAGG + Intergenic
1105890899 13:24681376-24681398 AAGCCAAGGTCGGCGGGAGGTGG + Intronic
1106467771 13:30028021-30028043 CAGCATAGGGCTGCAGGAGGAGG + Intergenic
1112041637 13:95553180-95553202 GAGCCTGGGACCCCGGGAGGGGG + Intronic
1114460752 14:22884795-22884817 CAGCCTGGGCCCGCCGGAGCTGG - Exonic
1118318446 14:64739418-64739440 CAGCATAGGGCAGCAGGAGGAGG - Intronic
1118839503 14:69500349-69500371 CAGCCCAGGACAGGGGCAGGGGG - Intronic
1122806582 14:104262998-104263020 CAGCCCAGGGCAGAGGGAGGGGG - Intergenic
1122812603 14:104296452-104296474 CAGCCTAGGGCCCCGGGAATAGG - Intergenic
1122979349 14:105184661-105184683 CTGCCTGGGGCCGGGGGAGGAGG + Intergenic
1123035625 14:105470794-105470816 CAGCCTAGGGCCGCCCGATGGGG - Intergenic
1124249243 15:28096531-28096553 CAGCCCAGGACCGGCTGAGGAGG - Intronic
1128384587 15:67138347-67138369 CATCCTGGGGCCGGGGGAGGGGG - Intronic
1129263534 15:74382132-74382154 CAGCCTGTGGCGGCGGGAGGGGG + Intergenic
1129757972 15:78110012-78110034 CAGGCCAGGATCGTGGGAGGTGG + Intronic
1131872744 15:96778409-96778431 CAGCATAGGACTAGGGGAGGGGG - Intergenic
1132556773 16:576068-576090 CAGCCTGGGGCCGCAGGAGGAGG - Intronic
1132733854 16:1376094-1376116 CAGCCTTGGAGTGAGGGAGGAGG - Intronic
1132733875 16:1376156-1376178 CAGCCTTGGACTGAGGGAGGAGG - Intronic
1132733886 16:1376192-1376214 CAGCCTTGGAGTGAGGGAGGAGG - Intronic
1133916463 16:10113357-10113379 TAGCCCAGGACCGGGGAAGGGGG - Intronic
1139553929 16:67694071-67694093 CAGCCTCAGAGCTCGGGAGGTGG - Intronic
1141657100 16:85422163-85422185 CAGCCAGGGACCAGGGGAGGAGG - Intergenic
1141848354 16:86626624-86626646 CAGCCTGGGAACGCAGGCGGGGG - Intergenic
1143253869 17:5541675-5541697 CACCCTTGGACAGAGGGAGGGGG - Intronic
1143527940 17:7483178-7483200 CAGCCTGGGACCAAGGGATGTGG + Exonic
1144340818 17:14309330-14309352 CAGCCTAGGGGCGGGGGAGGCGG - Intronic
1144862732 17:18315647-18315669 CAGCCTAGGACCCCGGGTTCGGG + Exonic
1145848704 17:28069076-28069098 CTGCCTAGGGCAGGGGGAGGGGG - Intronic
1146730821 17:35193092-35193114 CAGCCTGGGACCAAGGGATGTGG - Exonic
1146894931 17:36534451-36534473 CAGCTGAGGACCCCGGGAGGGGG - Intronic
1148562107 17:48612097-48612119 CAGCCTCGGAACGCGAGAGGAGG + Intronic
1150282114 17:63934722-63934744 CACCCTAGGATGCCGGGAGGGGG + Intergenic
1152118564 17:78404019-78404041 CAGCCTGGGACAGCAGGAGCGGG + Exonic
1152186012 17:78856626-78856648 CAGCCTGGGAGCCCTGGAGGCGG + Intronic
1152250018 17:79207648-79207670 GAGCTTAGGCCCGCGAGAGGAGG - Intronic
1152353733 17:79797132-79797154 GAGCGGAGGAGCGCGGGAGGGGG - Intronic
1152907675 17:82977769-82977791 CAGTCTGGGACCGAGGGGGGTGG + Intronic
1153565509 18:6414424-6414446 CAGCCTGGGACCGGGGGAGCGGG - Intronic
1153641655 18:7162882-7162904 CAGCCCAGGACCCCGAGAGATGG + Intergenic
1153698334 18:7666577-7666599 CAGCCTAGAACTGTTGGAGGTGG - Intronic
1158579730 18:58671289-58671311 CAGCCCGGGACCGCGGGGGAGGG + Intergenic
1160354233 18:78213495-78213517 GAGCCTAGGACTGAGGGAGCAGG - Intergenic
1160630682 18:80245188-80245210 CAGCCCAGGACTGCAGGATGAGG + Intronic
1162145334 19:8609609-8609631 CAGCCGGGGCCTGCGGGAGGAGG + Intronic
1163426793 19:17244782-17244804 CAGCCATGGAATGCGGGAGGAGG + Intronic
1163861852 19:19747027-19747049 CAGCCTTGGCCCAGGGGAGGAGG - Intergenic
1165305662 19:35000949-35000971 CAGCCAAGGACGGTGGGAGGGGG - Intronic
1166772682 19:45293852-45293874 CAGCCTGGGGCCGGGGGTGGTGG + Intronic
1167250667 19:48396945-48396967 CTGCCTGGGACTGAGGGAGGAGG - Intronic
1168096028 19:54115366-54115388 CAGCCGAGGACGGCGGGACGTGG + Exonic
1168432833 19:56294958-56294980 TTGCCTAGGACCGCGGGAGAGGG + Intronic
927475678 2:23412585-23412607 GAGCCTGGGACCGCTGGAGCTGG + Intronic
927638408 2:24832040-24832062 CAGACAAGGACCGGGGGAAGGGG + Intronic
929983949 2:46707558-46707580 CAGACTAGGACCGAGGCAGGAGG + Intronic
930011651 2:46942034-46942056 CACCCTCGGACCGCGGTGGGGGG - Intronic
930035545 2:47083151-47083173 CAGCCTAGCAGCCTGGGAGGAGG - Intronic
937890064 2:126931738-126931760 CTGCTTAGGACTGCGGGGGGAGG + Intergenic
940197003 2:151105859-151105881 CAGCCTAGGACCCAGAAAGGTGG - Intergenic
948468867 2:238164913-238164935 CCTCCTAGGACCTGGGGAGGAGG - Intronic
1175376759 20:58532604-58532626 CAGCATAGGACTGGGGAAGGAGG - Intergenic
1180064681 21:45406192-45406214 CAGCAGAGGCCCGGGGGAGGCGG + Intronic
1180089251 21:45525372-45525394 CAGCAGAGGCCCGCGAGAGGTGG + Intronic
1180837066 22:18935187-18935209 CAGCCTAGGACCCGTGGTGGCGG - Intronic
1181064891 22:20300836-20300858 CAGCCTAGGACCCGTGGTGGCGG + Intergenic
1183501456 22:38181918-38181940 CGCCCGAGGACGGCGGGAGGCGG + Intronic
1184118862 22:42437716-42437738 CAGCCCAGGACCCCTAGAGGGGG - Intergenic
1203287159 22_KI270734v1_random:160486-160508 CAGCCTAGGACCCGTGGTGGCGG - Intergenic
953405202 3:42656515-42656537 CAGCCTGGGACAGAGGGAGATGG + Intronic
955687519 3:61561941-61561963 CAGGCAGGGACCGCGGGCGGCGG - Exonic
962812574 3:138972161-138972183 CAGCTTAGGGCAGCTGGAGGCGG - Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
968456544 4:703512-703534 CAGCCAAGGCCCGAGGGTGGAGG - Intergenic
968940221 4:3633804-3633826 CAGCCTCAGACCCAGGGAGGTGG - Intergenic
971746924 4:30593649-30593671 CAGCCTAGGAATGAGTGAGGAGG + Intergenic
978930701 4:114307784-114307806 GAGCCAAGGAACCCGGGAGGCGG + Intergenic
992550171 5:77852075-77852097 CCGCCCCGGGCCGCGGGAGGAGG + Intronic
993287317 5:86016131-86016153 CAGCCAAGGGCTGGGGGAGGAGG + Intergenic
1001598912 5:172916278-172916300 CAGCCCAGGCCCTCAGGAGGAGG + Intronic
1004385647 6:15170434-15170456 CATCCTGGGACTGGGGGAGGTGG + Intergenic
1006439740 6:34046608-34046630 CAGCCTAGGACTGGCGGAGCTGG - Intronic
1017530016 6:155280450-155280472 CAGCCTAGAACCACGGCGGGAGG - Intronic
1018959196 6:168434697-168434719 CAGCTTAGGGCTGAGGGAGGAGG + Intergenic
1019154182 6:170027888-170027910 CAGCCTTGGCGAGCGGGAGGTGG + Intergenic
1023831379 7:44040550-44040572 CAGCCTAGCCCAGCGGGTGGAGG + Intergenic
1029741706 7:102494852-102494874 CAGCCTAGCCCAGCGGGTGGAGG + Intronic
1029759697 7:102594021-102594043 CAGCCTAGCCCAGCGGGTGGAGG + Intronic
1029777060 7:102689931-102689953 CAGCCTAGCCCAGCGGGTGGAGG + Intergenic
1031752453 7:125593709-125593731 CTGCCTAGGACTTTGGGAGGTGG - Intergenic
1033595298 7:142854847-142854869 CGGCCAAGACCCGCGGGAGGAGG + Intergenic
1034469773 7:151248959-151248981 CCGCCGAGGCCCGCGGGAGGCGG + Exonic
1034622056 7:152463994-152464016 GAGCCGAGGACCGCGGGCGGTGG + Intergenic
1038294329 8:26277142-26277164 CAGCCTAGCACTGTGGAAGGTGG - Intergenic
1038647462 8:29373375-29373397 CAGCCTAGTACTGAGGGCGGAGG + Intergenic
1039874954 8:41577834-41577856 CAGGCTGGCACCGCGGGAAGAGG - Intronic
1047421716 8:124712908-124712930 CAACCTAGTAATGCGGGAGGAGG - Intronic
1049090872 8:140512322-140512344 AAGCCTCGGACCGCTGGAGCTGG - Intronic
1049360683 8:142211308-142211330 CAGCCAAGGACTGAGGGTGGGGG - Intergenic
1052916089 9:33925261-33925283 CAGCCTAGAACCCCCGGAAGAGG + Intronic
1054450536 9:65401493-65401515 CAGCCTCAGACCCAGGGAGGTGG + Intergenic
1057226335 9:93295190-93295212 CAGTCTGGGACCGCGGGAGCTGG + Intronic
1058875000 9:109236537-109236559 CAGCCCAGGACAGCCTGAGGTGG - Intronic
1060212445 9:121718888-121718910 CCGCCTAGGACTGGGGGAGGGGG - Intronic
1061349589 9:130053961-130053983 CAGCCTAGGACCGCGGGAGGCGG - Exonic
1062253278 9:135608831-135608853 CAGCCCAGGACCTGGGGACGAGG + Intergenic
1193749723 X:85326909-85326931 CAGTCTGGGGCCGCGGGAGAAGG + Intronic
1199550252 X:149053652-149053674 GGGCCTAGGACAGGGGGAGGTGG - Intergenic
1200018622 X:153183330-153183352 CAGCCAAGGCCAGTGGGAGGGGG + Exonic
1200062827 X:153491224-153491246 GAGCCTAGGAGCCTGGGAGGTGG - Intronic