ID: 1061354352

View in Genome Browser
Species Human (GRCh38)
Location 9:130092913-130092935
Sequence CTGGCCCTAAATATTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061354347_1061354352 13 Left 1061354347 9:130092877-130092899 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1061354352 9:130092913-130092935 CTGGCCCTAAATATTTTTAATGG No data
1061354340_1061354352 27 Left 1061354340 9:130092863-130092885 CCCACATGGGCCTCCCAAAGTGC 0: 14
1: 1907
2: 76020
3: 257855
4: 249156
Right 1061354352 9:130092913-130092935 CTGGCCCTAAATATTTTTAATGG No data
1061354346_1061354352 14 Left 1061354346 9:130092876-130092898 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1061354352 9:130092913-130092935 CTGGCCCTAAATATTTTTAATGG No data
1061354341_1061354352 26 Left 1061354341 9:130092864-130092886 CCACATGGGCCTCCCAAAGTGCT 0: 21
1: 3610
2: 156923
3: 183831
4: 110923
Right 1061354352 9:130092913-130092935 CTGGCCCTAAATATTTTTAATGG No data
1061354344_1061354352 17 Left 1061354344 9:130092873-130092895 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1061354352 9:130092913-130092935 CTGGCCCTAAATATTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061354352 Original CRISPR CTGGCCCTAAATATTTTTAA TGG Intronic
No off target data available for this crispr