ID: 1061356489

View in Genome Browser
Species Human (GRCh38)
Location 9:130109465-130109487
Sequence AAGAATATCCCCAAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061356489_1061356492 13 Left 1061356489 9:130109465-130109487 CCAGCCTCTTTGGGGATATTCTT 0: 1
1: 0
2: 4
3: 21
4: 235
Right 1061356492 9:130109501-130109523 TTTTATCGTGTTATATAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061356489 Original CRISPR AAGAATATCCCCAAAGAGGC TGG (reversed) Intronic
903192541 1:21664907-21664929 AACAACATCCCCAGGGAGGCAGG + Intronic
903839905 1:26231462-26231484 AAGAATATATCTAAAGAGGTTGG + Intergenic
904453960 1:30635826-30635848 CAACAGATCCCCAAAGAGGCCGG + Intergenic
905090808 1:35429930-35429952 AAAAAAATCCCCAAAGATGCAGG - Intergenic
905176832 1:36141661-36141683 AAGAATGTGCCCAAGGAGGCTGG + Intronic
906115399 1:43353258-43353280 ACTAATATACTCAAAGAGGCAGG - Intergenic
906449849 1:45936109-45936131 AAGAATATGGCTAAAGAGGGAGG - Intronic
907170369 1:52457528-52457550 AAGAAAATCACAAAATAGGCTGG - Intronic
911451927 1:98073687-98073709 AAAAATATCAAAAAAGAGGCAGG + Intergenic
912335043 1:108854116-108854138 AGGAATATCCCCAAAGAGTCTGG - Intronic
914446309 1:147753357-147753379 AAGACTATATCCAAAGGGGCTGG - Intergenic
914834638 1:151197156-151197178 TAGAATATCCCCATGCAGGCCGG - Intergenic
915051979 1:153084618-153084640 GTGAATGTCCCCACAGAGGCAGG + Intergenic
915053591 1:153103608-153103630 GTGAACATCCCCACAGAGGCAGG + Intronic
916928427 1:169548570-169548592 TAAAATATCCCAAAAGAGCCGGG + Intronic
919895158 1:202005039-202005061 CAGAATATCCCCGAACAGGCAGG - Intronic
921403507 1:214753343-214753365 AAGAACATACCCAGAGACGCTGG + Intergenic
921485014 1:215704589-215704611 AAGGATGTGCCCAAAGAGACAGG - Intronic
921809966 1:219501616-219501638 TAAAATATGCCTAAAGAGGCAGG - Intergenic
922250927 1:223847582-223847604 AAGAATATCTACCAAGTGGCAGG - Intergenic
922600745 1:226850621-226850643 TAGAAAATACCCAAATAGGCTGG - Intergenic
923295889 1:232594626-232594648 AAGAATAGCTAGAAAGAGGCTGG - Intergenic
924698590 1:246426713-246426735 AAGAATATTCCCACAAAGGTTGG - Intronic
1063282618 10:4647184-4647206 AAGGATAAACCCACAGAGGCAGG + Intergenic
1063401850 10:5753654-5753676 AAGAATCTCGGCAAACAGGCTGG - Intronic
1063736099 10:8756939-8756961 AAGAATATTGCCAAAGTGACAGG - Intergenic
1063764158 10:9118283-9118305 TAGAATATCACAGAAGAGGCAGG + Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064104635 10:12490550-12490572 AAGAAAAACCACAAAGAGGCTGG + Intronic
1064590822 10:16889542-16889564 AAGAACATTCCCAAAGAAACTGG + Intronic
1068689197 10:59898741-59898763 AAATATAGCCTCAAAGAGGCAGG - Intronic
1070480017 10:76872975-76872997 AAAAATATGCCAAAAGAGGAAGG + Intronic
1070974676 10:80596838-80596860 AAGCATCTCCCCCAAGCGGCAGG - Intronic
1071281435 10:84107739-84107761 AATTATGTCCCCAAAGAGGGTGG + Intergenic
1071514506 10:86288291-86288313 AAGAACATCCCCAGGGAGCCTGG + Intronic
1071652368 10:87405032-87405054 AAGATTATCTCCACAGATGCAGG + Intergenic
1073785350 10:106883067-106883089 ATGGATATCTCCAAAGATGCTGG - Intronic
1074110374 10:110418427-110418449 AAGAATACAACCAAAGGGGCTGG - Intergenic
1076014317 10:127015479-127015501 AAGAAGAGCCCCGAAGAGGCAGG - Intronic
1078756148 11:14212280-14212302 CAGAATATCCCCAAAAAGCAAGG - Intronic
1083317595 11:61826207-61826229 AAGAATGGCTCCAATGAGGCCGG - Intronic
1085356401 11:75842110-75842132 AAGAATATCCCAAAAGGACCAGG + Intronic
1086052138 11:82605506-82605528 AAGTCTATACCCAAAGAGCCAGG + Intergenic
1086228993 11:84546049-84546071 AAGAACATCACCTAAGAGCCAGG - Intronic
1087000385 11:93413536-93413558 AATAAAATCATCAAAGAGGCTGG - Intronic
1087997086 11:104822469-104822491 AAGAATAGCACAGAAGAGGCTGG - Intergenic
1091852838 12:3714070-3714092 ATGTATATCACCAAGGAGGCTGG + Intronic
1093393765 12:18655274-18655296 AAAAATATTCCCAAAGACACAGG + Intergenic
1093746902 12:22752411-22752433 AAGAATATCCCCCAAGGAACAGG + Intergenic
1094012145 12:25820801-25820823 AAGAAGGTCAGCAAAGAGGCAGG - Intergenic
1096069212 12:48765523-48765545 AAAAATAGCTCCCAAGAGGCTGG - Intergenic
1098664494 12:73144416-73144438 AAGAATGTCCCCAACCAGACAGG - Intergenic
1098964750 12:76775109-76775131 AGGAATAACCACAAAGAGGCCGG - Intronic
1099072239 12:78059581-78059603 AAAAATATCCCCAAATAGGCGGG - Intronic
1099311483 12:81031345-81031367 GTGAAAATCCCCAATGAGGCAGG - Intronic
1102144101 12:110641613-110641635 AAGGATATCCCTTATGAGGCTGG - Exonic
1103767334 12:123290050-123290072 AAGAAGAAGCCCAAAAAGGCGGG - Exonic
1106266141 13:28112003-28112025 AAAAATATCCCAATTGAGGCTGG - Intergenic
1106657169 13:31758739-31758761 AAGAATATTCGTAAAGTGGCTGG + Intronic
1107368799 13:39717958-39717980 AAGAATATCAATAAAGAGACAGG - Intronic
1108582894 13:51841880-51841902 AAGAATGTTCCCTAAGAGACAGG + Intergenic
1109141993 13:58724583-58724605 AAGACTATCCACAAATAGGAAGG + Intergenic
1110331231 13:74275664-74275686 AAAAATACCCAAAAAGAGGCAGG - Intergenic
1110411834 13:75212823-75212845 AAATATATCCCCAAAGACTCTGG - Intergenic
1111984391 13:95051173-95051195 AAGAAAATCCCCACAGTTGCTGG + Intronic
1115312788 14:31996110-31996132 AAAAAAAACCACAAAGAGGCCGG - Intergenic
1118646511 14:67846189-67846211 ATGAATATGCACACAGAGGCTGG - Intronic
1121501799 14:94443909-94443931 AAGAATAACCCCAGAGAGAAAGG - Intronic
1121525357 14:94615578-94615600 AAGATAATCCCCAAGGAGCCTGG + Intronic
1123112375 14:105879179-105879201 AAGAATATTGACAAATAGGCTGG - Intergenic
1123781771 15:23635558-23635580 AAGAAAATCCCAAGGGAGGCCGG + Intergenic
1125823576 15:42656058-42656080 AAAAAAATCCAAAAAGAGGCTGG + Intronic
1127604951 15:60577076-60577098 TAGAATATCACCAAAGATTCTGG + Intronic
1128948020 15:71843765-71843787 AAGAATAGCCAAAAAGGGGCTGG - Intronic
1129351948 15:74960640-74960662 AAGACCCTGCCCAAAGAGGCTGG - Intronic
1129782795 15:78285024-78285046 AGGCATATCCCCACATAGGCTGG - Intronic
1132411136 15:101578973-101578995 GAGGATATCCCCAAGGATGCTGG + Intergenic
1133692608 16:8231081-8231103 AAGAATAACCCCAATGAAGTGGG + Intergenic
1133995203 16:10742881-10742903 AAGAAAATGCTCAAAGAAGCTGG + Intergenic
1138482764 16:57314767-57314789 AAGAAAACCCCCCAAAAGGCAGG - Intergenic
1138958839 16:62005439-62005461 AATAATATGCCCAGGGAGGCCGG + Intronic
1140155211 16:72417828-72417850 AAGAATCTCCTGAAAGAGACTGG + Intergenic
1141048376 16:80737816-80737838 AAGAATCTCTCCCATGAGGCTGG - Intronic
1142964228 17:3571011-3571033 CAGAAAAACCCCAAGGAGGCCGG - Intronic
1143098393 17:4490723-4490745 AGGACTGGCCCCAAAGAGGCAGG - Intergenic
1143832241 17:9661786-9661808 AAGAAAACCCTGAAAGAGGCTGG - Intronic
1144204606 17:12971246-12971268 CAGAAGATCACCAAGGAGGCTGG + Intronic
1144417098 17:15059627-15059649 TAGAAAATCCACAAATAGGCCGG + Intergenic
1149214735 17:54340355-54340377 AGGACTACCCCCAAAGAGGAAGG + Intergenic
1149625489 17:58077567-58077589 AAAATTATCCTCAAAAAGGCAGG + Intergenic
1150702417 17:67459412-67459434 AACTAAAACCCCAAAGAGGCTGG - Intronic
1151348065 17:73515498-73515520 CAGAATATCCCAGAAGAGACTGG + Intronic
1151606983 17:75143876-75143898 AAGAAAAACCCAAAAGGGGCTGG + Intronic
1153933156 18:9896631-9896653 AAAAATATCCTCACACAGGCTGG - Intergenic
1156218677 18:35028682-35028704 AATAATTTCCCGAAAGAGGGAGG + Intronic
1157864066 18:51165871-51165893 AAGAACAACCCAGAAGAGGCAGG + Intergenic
1158398545 18:57099059-57099081 CAGAATATACCCAAAGAGTCTGG - Intergenic
1159550594 18:69892019-69892041 AAGAGTAACCCCAAATATGCAGG - Intronic
1159967612 18:74610848-74610870 AAAAATGTCCCAAAATAGGCTGG - Intronic
1160604465 18:80039016-80039038 AAGAATATCCCAGATGAGGCTGG + Intronic
1163286595 19:16352295-16352317 AAGAAAATCCACATACAGGCAGG - Intergenic
1164278566 19:23747341-23747363 ATAAAAATCCCCAAAGTGGCCGG + Intronic
1166656295 19:44614408-44614430 AACAAAAACCCCAAACAGGCTGG - Intronic
1168483367 19:56740085-56740107 AGGAAAATCCCTAAACAGGCCGG - Intergenic
925047880 2:788415-788437 AAGCATATCACCAAAATGGCAGG + Intergenic
925208608 2:2027643-2027665 AAGAATACCCACTAAAAGGCTGG + Intronic
925701900 2:6647229-6647251 AAGAACATCCCATAAAAGGCGGG + Intergenic
926149843 2:10419322-10419344 AAGAACTGCCCCAAAGAGTCTGG + Intronic
928091958 2:28380178-28380200 AAGCATTTCCCCAAAGAGTGAGG - Intergenic
930867284 2:56134272-56134294 AAGAATCTCTCCAAAGAAGCAGG - Intergenic
931411210 2:62033811-62033833 AAAAATATATCAAAAGAGGCTGG + Intronic
932158825 2:69442369-69442391 AAGAATACTCACAAATAGGCCGG - Intergenic
932310362 2:70734646-70734668 GAGCATATCCCCAAAGATACTGG - Intronic
933577520 2:84086631-84086653 CAAAATATCCCCCAAGAAGCAGG + Intergenic
933647339 2:84823430-84823452 AAGAACTACCCCAGAGAGGCTGG - Intronic
935379792 2:102439990-102440012 AAGACAATCCTCAAAGAGGATGG + Intronic
935402652 2:102676265-102676287 AAGAAAAGCCTCAGAGAGGCAGG - Intronic
935678247 2:105614709-105614731 AAGAATATGCAAAAACAGGCTGG + Intergenic
936592471 2:113817371-113817393 AAAAATATATCCAAAAAGGCCGG + Intergenic
937847641 2:126599160-126599182 AAGAATACCAACAAAGAGACAGG + Intergenic
941706869 2:168668147-168668169 AAGAAAATCAGAAAAGAGGCTGG - Intronic
942188813 2:173450664-173450686 AAGATTTTTCCGAAAGAGGCAGG + Intergenic
942247370 2:174020146-174020168 AAGAGTTTCCCCAAAGCTGCTGG + Intergenic
945202571 2:207297433-207297455 ATAAAAATCCCCAGAGAGGCTGG + Intergenic
946633387 2:221697009-221697031 AACAATATCCTCAAAGACTCAGG + Intergenic
1170021785 20:11844713-11844735 TAGGATAACTCCAAAGAGGCAGG + Intergenic
1170886544 20:20344371-20344393 AGGAATTTCACCAAAGAGTCTGG + Intronic
1171515945 20:25735634-25735656 AATAATATCCCAATAGAGGCGGG - Intergenic
1172928784 20:38566374-38566396 AGGTATGTCCCCAAAGAGGACGG - Intronic
1173802446 20:45902858-45902880 AAGGACATCCACAAAGAGTCTGG - Intronic
1175197467 20:57254317-57254339 AAGAAGAAACCAAAAGAGGCTGG - Intronic
1175459797 20:59143821-59143843 AAGAAAATCCCCAACCAGGCTGG + Intergenic
1176113291 20:63420345-63420367 AAGAATCTCCCCAAAAACCCTGG + Intronic
1177798224 21:25801273-25801295 AAGAAATGTCCCAAAGAGGCTGG - Intergenic
1178118351 21:29440929-29440951 AAGAATATCCCTAAACAGAAAGG - Intronic
1178194363 21:30326471-30326493 AATAATATCCCCAGTGAAGCTGG - Intergenic
1179814880 21:43899199-43899221 AAGCATATCCCCCAAGGGGCAGG - Intronic
1179987689 21:44930588-44930610 CAGAATATGCCCAGTGAGGCTGG + Intronic
1181497357 22:23295093-23295115 ACGAAGATCCCCAAGGAGGACGG + Exonic
1181924912 22:26350526-26350548 AAGAATTTGCCCAAAGAGGTGGG - Intronic
1182749252 22:32628487-32628509 AAGTGCAGCCCCAAAGAGGCTGG + Intronic
1182849755 22:33462484-33462506 AAAAATATACCCACTGAGGCTGG + Intronic
1183262905 22:36807416-36807438 AATCAAATCCCCATAGAGGCCGG + Intronic
1183520462 22:38293702-38293724 AAACATAGCCCCAAAGAGGATGG + Intronic
949520030 3:4842978-4843000 GAGAATATGCACTAAGAGGCTGG + Intronic
949850501 3:8415801-8415823 AAAAATTTCCCATAAGAGGCTGG - Intergenic
952325476 3:32316651-32316673 AAAAAAATCCCCAAACAAGCAGG - Intronic
952743841 3:36760045-36760067 AAGAATTTCCTCCAGGAGGCTGG + Intergenic
953469769 3:43156764-43156786 AACAACAGCCCCAAAGTGGCAGG + Intergenic
953551290 3:43905717-43905739 CACAATATCTGCAAAGAGGCAGG - Intergenic
954243659 3:49313558-49313580 ATGACTTTCCCCAAAAAGGCTGG + Intronic
955910715 3:63857012-63857034 AAGAATATCTATAATGAGGCCGG - Intronic
956273705 3:67475431-67475453 GAGCACATCCCCAAAGAGGCAGG + Intronic
958561034 3:95746637-95746659 AATAATATTCACAAACAGGCTGG + Intergenic
959759963 3:109949820-109949842 AGGATTTTCTCCAAAGAGGCAGG + Intergenic
960646593 3:119891882-119891904 AACAACATCCCCAAAGGGGTGGG - Intronic
967110420 3:186288576-186288598 AGAAACCTCCCCAAAGAGGCGGG + Intronic
970870518 4:20811958-20811980 AAGAATATACCCTAAGAGACAGG + Intronic
971023179 4:22559378-22559400 AAGATTATCTCCACAGAGGTAGG - Intergenic
971106622 4:23532234-23532256 AAGCATTTGCCCAAAGAGGTAGG + Intergenic
972059162 4:34846874-34846896 AAGAAAATCTCCACAGAGCCTGG + Intergenic
974109077 4:57505846-57505868 AAAAATACACCCAAAGAGTCTGG - Intergenic
976922123 4:90454019-90454041 AAGACTATCCCCAGAGACACAGG - Intronic
978270763 4:106887027-106887049 AAGAATATAACCCAAGAGGAGGG + Intergenic
978658050 4:111089903-111089925 AAAAATATCTCCAAAGAAGCAGG + Intergenic
982970237 4:161975817-161975839 AAGATTATCTCCAAGCAGGCTGG + Intronic
983070690 4:163264544-163264566 GAGAAGATCCCCTTAGAGGCCGG - Intergenic
984960940 4:185097995-185098017 AAGATTATGCCCAAACAAGCTGG + Intergenic
986983998 5:13479857-13479879 AAGAATCTCCCCAAAGACAAAGG - Intergenic
988614641 5:32763608-32763630 AAAAAGATGGCCAAAGAGGCTGG - Intronic
989764122 5:45059195-45059217 CAGAATATCCCAAAAGAGCTGGG - Intergenic
990727478 5:58772950-58772972 AAGAACAACCCAAAAGAAGCAGG + Intronic
992389588 5:76318032-76318054 AGAAAAATCCACAAAGAGGCTGG + Intronic
993908453 5:93650692-93650714 AAGAAAATCCACAACTAGGCTGG + Intronic
994092815 5:95823855-95823877 CAGAGTATCTTCAAAGAGGCGGG + Intronic
995072739 5:107943039-107943061 AAGCAAATACCCAGAGAGGCAGG - Intronic
996235382 5:121123224-121123246 AAAAATATGCCCAAAGAGTAAGG - Intergenic
998547905 5:143047183-143047205 GTAAATATCCCCATAGAGGCAGG + Intronic
998585480 5:143422328-143422350 AAGAACATGACCAAAGAGCCAGG + Intronic
999486200 5:151998797-151998819 AAGTATAACCCCAAAGAGCAAGG - Intergenic
1000755577 5:165155151-165155173 AAAAATATATCCAAAGAGACAGG + Intergenic
1001460315 5:171906561-171906583 AAGAAAAAGCCCAGAGAGGCAGG - Intronic
1001522960 5:172408021-172408043 TAGAACAGCACCAAAGAGGCCGG - Intronic
1003087536 6:3072775-3072797 AAGAATATGGCCTAAGAGGGTGG + Intronic
1003867664 6:10378265-10378287 AAGGATATCCCTAAAGAAGATGG + Intergenic
1004074854 6:12335843-12335865 ATGAATAACCCTTAAGAGGCAGG - Intergenic
1004179628 6:13370018-13370040 AAAAAAATCCACAAAGAGACAGG + Intronic
1005570192 6:27137987-27138009 AAGAAAATCACCAAATGGGCCGG + Intergenic
1006494675 6:34413759-34413781 AAAAAAATCTCCTAAGAGGCCGG - Intronic
1007006676 6:38370240-38370262 AATAATATATTCAAAGAGGCAGG - Intronic
1007608643 6:43134333-43134355 AAAAGTATCCCTAATGAGGCCGG - Intronic
1011369415 6:86617616-86617638 AAAATAATCCCCAAAAAGGCAGG + Intergenic
1019177688 6:170168686-170168708 AGGAACAACCCCAAACAGGCAGG - Intergenic
1019178148 6:170171175-170171197 AGGAACAACCCCAAACAGGCAGG - Intergenic
1019178165 6:170171275-170171297 AGGAACAACCCCAAACAGGCAGG - Intergenic
1019178195 6:170171455-170171477 AGGAACAACCCCAAACAGGCAGG - Intergenic
1019178245 6:170171755-170171777 AGGAACAACCCCAAACAGGCAGG - Intergenic
1019178298 6:170172057-170172079 AGGAACAACCCCAAACAGGCAGG - Intergenic
1019940905 7:4289892-4289914 AAGAATATCTTCAAAGATACTGG - Intergenic
1023106997 7:36772291-36772313 AAGAAGAGCCCCATAGTGGCAGG - Intergenic
1023743524 7:43301927-43301949 AAAAATAAACCCAAAGATGCTGG + Intronic
1024237581 7:47409639-47409661 AAGAATAGGCCAAGAGAGGCTGG - Intronic
1024777616 7:52806248-52806270 ATAAAAATCCTCAAAGAGGCCGG + Intergenic
1025535189 7:61938881-61938903 GAGAATATCCCCAGATAGGAAGG + Intergenic
1028271788 7:88800460-88800482 AAGAATATTTCCATAGAGCCTGG - Intronic
1029237104 7:99130154-99130176 AAAAATACTCCCAAATAGGCTGG + Intronic
1029540305 7:101178942-101178964 AAGAATGTCCCCAAGGATGTGGG - Intronic
1030639004 7:111983333-111983355 AAAGATATGCCAAAAGAGGCAGG + Intronic
1031220571 7:118959386-118959408 AAGAACTTCCCAGAAGAGGCAGG - Intergenic
1032753490 7:134865747-134865769 ATGAATATCTCCAAGCAGGCTGG - Intronic
1034003955 7:147447714-147447736 AAAAATTACCCCAAATAGGCTGG - Intronic
1034939945 7:155224104-155224126 AAGAATATCCCCAAATGAGAAGG + Intergenic
1036183222 8:6602460-6602482 CAGATTCTCCCCAGAGAGGCTGG - Intronic
1036433939 8:8715390-8715412 AAGAATAACCCCACAGAGGAAGG + Intergenic
1038601350 8:28946246-28946268 AAGAATATCCCCTATGGGCCGGG - Intronic
1039435499 8:37556780-37556802 AAGAGCATCCCCCTAGAGGCAGG + Intergenic
1039629667 8:39096850-39096872 GAGAATATCAACAAAGAGACAGG - Intronic
1040104544 8:43534367-43534389 AAGACTGTCCCCACAGAGCCAGG - Intergenic
1040995785 8:53400777-53400799 AAGAATATATCCAATGAGGCTGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1041809258 8:61889141-61889163 ATGAATATCCTCACAGAGGAGGG + Intergenic
1042267738 8:66925847-66925869 CAGAATATGCCCTAAAAGGCCGG + Intergenic
1042653014 8:71063599-71063621 ATGAATACCCCCAAAGGGGAAGG + Intergenic
1043519367 8:81027607-81027629 AAGAATATAGGCCAAGAGGCCGG + Intronic
1044607829 8:94062498-94062520 GAGAATGACCCCAAAGAGGGTGG - Intergenic
1045996280 8:108365759-108365781 AAGAAAATCTTCAAAGAAGCTGG - Intronic
1047531853 8:125684163-125684185 AAGAATGACTCTAAAGAGGCAGG - Intergenic
1050007931 9:1153764-1153786 AAGATTATCTCCACAGATGCAGG - Intergenic
1050726485 9:8655283-8655305 ACACATTTCCCCAAAGAGGCAGG - Intronic
1052083291 9:24233080-24233102 AAGAAAATCTCCAAAGATGTTGG + Intergenic
1052882296 9:33609565-33609587 AAGAATATCAACAAAGAGATTGG + Intergenic
1053326232 9:37154182-37154204 ATCAAGATCCCCAAAGAGCCAGG - Intronic
1053494024 9:38536176-38536198 AAGAATATCAACAAAGAGATTGG - Intergenic
1055109083 9:72542025-72542047 AAGAATTTGACCTAAGAGGCCGG + Intronic
1055123497 9:72691469-72691491 AAGAGTTTCACCAATGAGGCAGG + Intronic
1055697375 9:78900635-78900657 AAGTATTTACCCCAAGAGGCTGG + Intergenic
1056955907 9:91081021-91081043 GAGAATATGCCCAAGGTGGCTGG + Intergenic
1057097094 9:92320901-92320923 AAGAATATACAGATAGAGGCCGG - Intronic
1057787956 9:98102245-98102267 AAGACTGTCTGCAAAGAGGCAGG - Intronic
1058693547 9:107539623-107539645 AAGAATGTCCCCAAACTGGCCGG + Intergenic
1059008998 9:110436084-110436106 AAGAATATCACCAAAGAAGCAGG - Intronic
1059015949 9:110515594-110515616 TAAAATATCCCCACATAGGCCGG - Intronic
1059085589 9:111299165-111299187 CATAATATTCCCAAGGAGGCAGG - Intergenic
1060291760 9:122309371-122309393 AAGACTATCCCAAAAGAGAAGGG - Intronic
1060794170 9:126503446-126503468 AACAATGTCCCCAGGGAGGCCGG - Exonic
1061356489 9:130109465-130109487 AAGAATATCCCCAAAGAGGCTGG - Intronic
1062108489 9:134768533-134768555 AACAACAACCCCAAAGAGCCTGG - Intronic
1187394299 X:18906562-18906584 CAGCATCTCCACAAAGAGGCTGG + Exonic
1189084697 X:38009757-38009779 AAGAACATAGCCAAAGAGCCAGG + Intronic
1190219119 X:48499598-48499620 AAGAATTTCCTCAAGGGGGCCGG + Intergenic
1192930166 X:75798733-75798755 AACAACAGCCCCAAAGAGGAGGG - Intergenic
1193102924 X:77636299-77636321 AAGAATAGCACCAAAGGGGATGG - Intronic
1195534660 X:105997744-105997766 TAAAATATCGCCAAAGGGGCTGG + Intergenic
1196096968 X:111810206-111810228 TAGAATATGGCAAAAGAGGCAGG - Intronic
1196205127 X:112930933-112930955 AATCATATCCCCCAAGATGCTGG + Intergenic
1196780741 X:119381847-119381869 AAGAATTTCCCCAAAGTGGATGG - Intergenic
1197056801 X:122131410-122131432 GAGAATATCCACAAAGATACGGG - Intergenic
1197373530 X:125654377-125654399 AAGAATATCAACAAAGAGGCCGG - Intergenic
1198049820 X:132939918-132939940 ATCAATATCCACAAAGAAGCCGG - Intronic
1199245500 X:145599282-145599304 AAGGAGCTCCCAAAAGAGGCCGG + Intergenic
1199935957 X:152573867-152573889 ATTAAAATCCCTAAAGAGGCTGG + Intergenic