ID: 1061357684

View in Genome Browser
Species Human (GRCh38)
Location 9:130118869-130118891
Sequence CAGCTGGGTGTGCCTGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 9, 3: 45, 4: 346}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061357684_1061357698 23 Left 1061357684 9:130118869-130118891 CCAAGGGCAGGCACACCCAGCTG 0: 1
1: 0
2: 9
3: 45
4: 346
Right 1061357698 9:130118915-130118937 GGCCTCCTGGATCCTGCCTGGGG No data
1061357684_1061357697 22 Left 1061357684 9:130118869-130118891 CCAAGGGCAGGCACACCCAGCTG 0: 1
1: 0
2: 9
3: 45
4: 346
Right 1061357697 9:130118914-130118936 AGGCCTCCTGGATCCTGCCTGGG No data
1061357684_1061357692 -6 Left 1061357684 9:130118869-130118891 CCAAGGGCAGGCACACCCAGCTG 0: 1
1: 0
2: 9
3: 45
4: 346
Right 1061357692 9:130118886-130118908 CAGCTGAGATGGGGCAGGGCTGG No data
1061357684_1061357694 2 Left 1061357684 9:130118869-130118891 CCAAGGGCAGGCACACCCAGCTG 0: 1
1: 0
2: 9
3: 45
4: 346
Right 1061357694 9:130118894-130118916 ATGGGGCAGGGCTGGAAGGCAGG No data
1061357684_1061357696 21 Left 1061357684 9:130118869-130118891 CCAAGGGCAGGCACACCCAGCTG 0: 1
1: 0
2: 9
3: 45
4: 346
Right 1061357696 9:130118913-130118935 CAGGCCTCCTGGATCCTGCCTGG No data
1061357684_1061357689 -10 Left 1061357684 9:130118869-130118891 CCAAGGGCAGGCACACCCAGCTG 0: 1
1: 0
2: 9
3: 45
4: 346
Right 1061357689 9:130118882-130118904 CACCCAGCTGAGATGGGGCAGGG No data
1061357684_1061357695 10 Left 1061357684 9:130118869-130118891 CCAAGGGCAGGCACACCCAGCTG 0: 1
1: 0
2: 9
3: 45
4: 346
Right 1061357695 9:130118902-130118924 GGGCTGGAAGGCAGGCCTCCTGG No data
1061357684_1061357693 -2 Left 1061357684 9:130118869-130118891 CCAAGGGCAGGCACACCCAGCTG 0: 1
1: 0
2: 9
3: 45
4: 346
Right 1061357693 9:130118890-130118912 TGAGATGGGGCAGGGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061357684 Original CRISPR CAGCTGGGTGTGCCTGCCCT TGG (reversed) Intronic
900844625 1:5087005-5087027 TCCCTGGGTGTGGCTGCCCTGGG + Intergenic
901274872 1:7983486-7983508 AAGCTGGTGGTGCCTGCACTAGG - Intronic
901650562 1:10740510-10740532 CACCATGGTGTGGCTGCCCTGGG - Intronic
901676935 1:10890829-10890851 CAGGAGTGTGTGCCTGGCCTGGG - Intergenic
902765800 1:18614194-18614216 CAGCTGGGAGGCCATGCCCTGGG + Intergenic
903041115 1:20531372-20531394 TGGCTGTGTCTGCCTGCCCTTGG - Intergenic
903153473 1:21429107-21429129 CAGCTGGGCCCGCTTGCCCTCGG - Intergenic
903368538 1:22819549-22819571 CAGCTGGGGTTGAGTGCCCTTGG - Intronic
904688147 1:32275168-32275190 CAGCTCGGGGTGGCCGCCCTTGG + Intronic
904789846 1:33011274-33011296 CAGCTATGTGTGCCTGGTCTGGG - Intronic
904883346 1:33717154-33717176 CAGCTGGGTGTGGCTACTCCTGG + Intronic
905091530 1:35434599-35434621 CAGCTGGCTGGGTCTGCCCTCGG + Exonic
906151294 1:43589116-43589138 TTCCTGGGTGTCCCTGCCCTGGG + Intronic
907655991 1:56342387-56342409 CACCTGGCTGAGGCTGCCCTAGG - Intergenic
908930815 1:69314773-69314795 TGGCTGGCTGTGCCTGTCCTTGG + Intergenic
909197709 1:72648580-72648602 CAGCTGGGTGTGCATGCGCTCGG + Intergenic
909327773 1:74373821-74373843 CAGCTGGCTTTGCTTGCCATGGG - Intronic
912696881 1:111848659-111848681 CTGCTGGGTGGGCCAGCCCCAGG - Intronic
912958152 1:114170681-114170703 TAGATGGCTGTCCCTGCCCTGGG + Intergenic
913089660 1:115467969-115467991 GAGGTGGGTGGGGCTGCCCTGGG - Intergenic
915542389 1:156576078-156576100 CAGCTGGGTTAGCCTGCCTTGGG + Intergenic
915562703 1:156696608-156696630 CAGCTGTGAGTGCCTAGCCTGGG + Intergenic
915565923 1:156712624-156712646 CAACTGACTGTCCCTGCCCTGGG - Intergenic
916966200 1:169945175-169945197 TGGCTGGGTGTGCCTGCACTTGG - Intronic
919924145 1:202183592-202183614 CAGCTGGGTCAGCCTGACCCTGG - Intergenic
922350089 1:224728248-224728270 GAGCTGGGTGCGCCAGCCCCGGG - Intronic
1062910390 10:1208438-1208460 CACCTGGGTGTGTCTGTCCCTGG + Intronic
1062933756 10:1369785-1369807 AAGCTCAGTGTGCCTGCTCTAGG - Intronic
1064451630 10:15447174-15447196 TAGCTGGGTGTGCCTGTACTGGG + Intergenic
1070153638 10:73820119-73820141 GAGCTGGGAGAGCATGCCCTGGG - Intronic
1070733320 10:78846640-78846662 CAGCCGGGTGCATCTGCCCTGGG - Intergenic
1070922733 10:80198384-80198406 CAGCTAGGAGGGCCTGCCATGGG + Intronic
1070966986 10:80535973-80535995 AACCTGGGTGTGCCTGGCCTGGG - Intergenic
1072543713 10:96417975-96417997 CAGGAGGGGCTGCCTGCCCTCGG + Intronic
1072895802 10:99365527-99365549 CAGCTGGCTGTGCATGCTGTTGG + Intronic
1073163234 10:101419692-101419714 CCGCTTGGTATGCATGCCCTTGG - Intronic
1074229951 10:111523764-111523786 TAGCTATGTGTGCCTGACCTAGG + Intergenic
1074229959 10:111523830-111523852 TAGCTATGTGTGCCTGACCTAGG + Intergenic
1074301896 10:112240662-112240684 CAGCCAGGTGTGCGTGCACTTGG - Intergenic
1075007730 10:118842602-118842624 CAGCTGGGTGTGCACACACTCGG + Intergenic
1075016735 10:118915184-118915206 CATCTCTGTGTGCCTGCCCTGGG - Intergenic
1075400126 10:122155055-122155077 CAGCTACCTGTGACTGCCCTGGG - Intronic
1075671590 10:124267062-124267084 CAGCTGTGTGTGCTTGGCCTGGG - Intergenic
1076055468 10:127368657-127368679 CACCTGGATGAGCCTGCCCTTGG + Intronic
1076168744 10:128302977-128302999 CAGCTGTGTCTGCCTGACCCCGG - Intergenic
1076917332 10:133430830-133430852 CAGCTGGCTCTGCCTGCACCTGG - Intergenic
1076937429 10:133575589-133575611 CAGCTGGCTCTGCCTGCACCTGG - Intergenic
1077189950 11:1251794-1251816 AACCTGGGTCTGCCTGTCCTGGG + Intronic
1077298374 11:1836370-1836392 CAGCTGGGTGGGCCTGAGCTAGG + Intronic
1080106911 11:28520414-28520436 GACCTGGGTGAGGCTGCCCTGGG + Intergenic
1080192486 11:29568845-29568867 CAGCTGGGCGTTCATGCCCAGGG - Intergenic
1080783321 11:35451120-35451142 CAGTTGGGTTTTTCTGCCCTTGG + Intronic
1081992677 11:47346303-47346325 CAGATGGGGGTGCCTGCCGTAGG + Exonic
1083292815 11:61699316-61699338 CAGCCAGGTGAGCATGCCCTGGG + Intronic
1084041590 11:66545999-66546021 CAGCTGGGTGTCCAGGCCATGGG - Exonic
1085476783 11:76794058-76794080 CATCTGGGTGGCCCTGCTCTGGG - Intronic
1087789725 11:102393370-102393392 CAGCAGGGTGTCTGTGCCCTGGG - Intergenic
1089616797 11:119699428-119699450 GAGCTGGGTGTGGCCGGCCTGGG - Intronic
1089681710 11:120122291-120122313 AGGGTGGGTGTGCCAGCCCTCGG - Intronic
1089858342 11:121566968-121566990 CAGCCTGCTGTGCCTGCCCAAGG + Exonic
1090347437 11:126082778-126082800 CGGCTGGGGCTGCCTGCCCTGGG - Intergenic
1090365703 11:126203554-126203576 CAGCTGATCCTGCCTGCCCTGGG - Exonic
1091205431 11:133817778-133817800 CAGCTGGGTCTGCCGACTCTGGG - Intergenic
1095890564 12:47231832-47231854 CAGCTCGATGTGCCTTCCCTGGG - Intronic
1096525793 12:52209545-52209567 CAGCTGGCCCTGTCTGCCCTTGG + Intergenic
1096658448 12:53106031-53106053 CAGATAGGTGTGCCTGTCCCAGG - Intronic
1097435039 12:59545322-59545344 CAGATGGGTGTGCAATCCCTGGG - Intergenic
1098100466 12:67010821-67010843 GAGTTGGGTGTTCCTGCGCTGGG - Intergenic
1099049829 12:77768527-77768549 CAGCTGGATGTGCATGTGCTTGG - Intergenic
1101616820 12:106345906-106345928 CAGCTGGGTTTCCCTCTCCTTGG + Intronic
1102035407 12:109768315-109768337 CAGCTTGGTCCGCTTGCCCTCGG - Exonic
1102151086 12:110689338-110689360 CCGCAGGGTGGGCCTGTCCTGGG + Intronic
1102240727 12:111322979-111323001 CAGCTGGGTGGCACTGCCCAAGG - Intronic
1102320365 12:111928299-111928321 CAGCAGGGTGTGGTTGCTCTTGG - Intergenic
1102733712 12:115138371-115138393 CAGCCTGGTGTCCCAGCCCTGGG - Intergenic
1103539531 12:121656192-121656214 CAGCAGAGTGTGTCTGCCCTGGG - Intronic
1103913220 12:124363263-124363285 CAGCTGGGTGCGTGGGCCCTTGG - Intronic
1103919791 12:124393347-124393369 CGGCTGTGGCTGCCTGCCCTGGG - Intronic
1105954650 13:25269016-25269038 TAGCTGGGTGTGCATGTGCTTGG + Intronic
1107012262 13:35680763-35680785 CTGCTGTGTGTCCCTGCCCCTGG + Intergenic
1108576506 13:51795917-51795939 GAAGTGTGTGTGCCTGCCCTGGG - Intronic
1109353779 13:61216321-61216343 CAGGTGGGTGTACATCCCCTGGG - Intergenic
1109470578 13:62799246-62799268 CAGCTGGGTGAGCCCACGCTTGG + Intergenic
1110487687 13:76066128-76066150 CAGTTTGGTGTTCCTGCCATAGG + Intergenic
1110730859 13:78877169-78877191 CAGCCAGGTGTGCATGCACTTGG - Intergenic
1111595315 13:90403769-90403791 TGGCTGGGTGTGCATGCGCTTGG + Intergenic
1112164097 13:96899132-96899154 CAGCAGGGTCTGGCTGCCCAAGG + Intergenic
1113229254 13:108194775-108194797 CAGCTAGGTGTGCATACACTTGG + Intergenic
1113472174 13:110554950-110554972 CAGCTTGGTCTTCCTGCCCTTGG - Intronic
1113474663 13:110571911-110571933 CAGCTGGGAGCCTCTGCCCTGGG - Intergenic
1113660624 13:112104589-112104611 GAGCTGGGTGTCCATGGCCTGGG - Intergenic
1114069258 14:19095010-19095032 CAGCTGGGCTTGCCTGAGCTGGG + Intergenic
1114093003 14:19304992-19305014 CAGCTGGGCTTGCCTGAGCTGGG - Intergenic
1115310643 14:31974923-31974945 CAGCTGGGTGTGCGTACACTTGG - Intergenic
1116012310 14:39366224-39366246 GAGCTGAGTGTGCCTGTCCTTGG + Intronic
1116574665 14:46557641-46557663 CTGGTGTGTGTGCCTGCCATTGG - Intergenic
1117378619 14:55138161-55138183 CCCCTGGGGGTGCCTGCCCGGGG - Exonic
1120423464 14:84316640-84316662 GGGCTGAGTGTGCCTGTCCTTGG - Intergenic
1121784654 14:96648696-96648718 AGGCTGAGTGTGCCTGTCCTTGG + Intergenic
1122266269 14:100548360-100548382 CAGCCCATTGTGCCTGCCCTAGG - Intronic
1122319110 14:100843034-100843056 AAGCTGCGTGTGCCAGCTCTGGG - Intergenic
1122864492 14:104597340-104597362 CAGCTCCGTGTGCCCACCCTGGG + Intronic
1123048714 14:105530578-105530600 CATCTGGCTGTGGCTGTCCTGGG - Intergenic
1123063041 14:105602884-105602906 CAGCTGGGCTGGCCTGGCCTCGG - Intergenic
1123491650 15:20786065-20786087 CAGCGGGGTGTGCAAGCGCTGGG - Intergenic
1123548153 15:21355159-21355181 CAGCGGGGTGTGCAAGCGCTGGG - Intergenic
1123705970 15:22951425-22951447 CAGCATGGGGGGCCTGCCCTTGG + Intronic
1124372403 15:29111151-29111173 CGGCTCGGTGTCTCTGCCCTGGG + Intronic
1124434179 15:29634048-29634070 CAGCTTGGTGTGGCTGCCAGTGG - Intergenic
1124917262 15:33987892-33987914 CTGCTGGGTCTGCATGCCCTGGG + Intronic
1128559974 15:68658340-68658362 CAGCTGGGTGAGCCTGGCTGGGG + Intronic
1128995081 15:72289572-72289594 CAGGTGGGTGGGCCAGGCCTGGG - Intronic
1130317631 15:82809954-82809976 CAGCTGGGCCGGCCTGCTCTCGG + Exonic
1132147036 15:99435238-99435260 TTGCAGGGTGTGCCAGCCCTGGG + Intergenic
1132355351 15:101167760-101167782 AAGCTGGGTGTGCATGGGCTTGG + Intergenic
1202956484 15_KI270727v1_random:82389-82411 CAGCGGGGTGTGCAAGCGCTGGG - Intergenic
1132621759 16:871128-871150 CAGCTGGGGGCCCCTGCCCAAGG - Intronic
1132678605 16:1130782-1130804 AAGCTGGGTGAGGCTCCCCTGGG + Intergenic
1133071057 16:3246996-3247018 CAGGTGGGTGTGCCTGGGCCCGG - Exonic
1133144299 16:3772491-3772513 CAGCTCAGTGTGTTTGCCCTGGG - Intronic
1135435553 16:22424698-22424720 GAGCTGGGGGTGCCAGCACTTGG - Intronic
1135891389 16:26360495-26360517 CAGCTGGGTGAGGCTGCAGTAGG + Intergenic
1137365943 16:47859513-47859535 CAGCTGGGTGTCCTGGCCCTGGG + Intergenic
1137536497 16:49330890-49330912 AAGATGGGTGTGCCAGCCCTAGG - Intergenic
1138396051 16:56705555-56705577 CAGCAGGGAGGGCCTGCCCTGGG + Intronic
1138456431 16:57123646-57123668 CTGCTGGGTGTGCCTGAGTTGGG + Intronic
1139251822 16:65503922-65503944 CAGCTTGCTGGCCCTGCCCTGGG - Intergenic
1139657143 16:68395967-68395989 CAACTCAGTGTGCCTGGCCTGGG + Intronic
1142044757 16:87918503-87918525 GAGCTGGGGGTGCCAGCACTTGG - Intronic
1142363334 16:89637414-89637436 GAGCTGGGAGGGCCTGCCCAGGG - Intronic
1142960817 17:3551465-3551487 CAGCTGGGTGTGGTTGACCCAGG + Intronic
1143015632 17:3889865-3889887 CAGCAGGGTCTGCCTGCTCTGGG - Intronic
1143220156 17:5254961-5254983 CAGCTGGGTATTCCTGCCTATGG + Intergenic
1143303816 17:5930277-5930299 CATCTTGGGGTGCGTGCCCTTGG + Intronic
1144729846 17:17520024-17520046 CAGCTCAGCGTGCCAGCCCTGGG + Intronic
1145941873 17:28746981-28747003 CAGCTGTCTGTGCCTCCTCTAGG + Intronic
1147161550 17:38572037-38572059 CTGCTGGGGATGCCTGCCCAGGG - Intronic
1147214236 17:38890215-38890237 CAGCTGGGACTGGCTGACCTGGG - Intronic
1147421269 17:40323227-40323249 CATCTGGCTGTGCCTGACCGTGG + Intronic
1147674088 17:42192972-42192994 CTGCTGGGTCTGGCTGGCCTTGG + Exonic
1147854425 17:43468094-43468116 CAGCTGATTCTGCCTGCCCAGGG + Intergenic
1147952165 17:44113297-44113319 CCTCTGGGTGTCCCTGTCCTGGG - Intronic
1148442664 17:47719859-47719881 CTGCTGGGTGTGCAAGCCCAGGG - Intergenic
1149238869 17:54625039-54625061 CAGCTGGGTGTTTCTGGCTTGGG - Intergenic
1151453802 17:74214504-74214526 AAGCCGGGAGTGACTGCCCTAGG - Intronic
1151819794 17:76491291-76491313 CAGCTGGGATGGCCTGGCCTTGG - Intronic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152945057 17:83193633-83193655 CAGCTGGGTGTGTGTCTCCTGGG - Intergenic
1153816958 18:8799041-8799063 CAGCTGGATGCCCCTGCCCTAGG + Intronic
1153950668 18:10055057-10055079 CTGCTAGGTTTGCTTGCCCTGGG + Intergenic
1154191808 18:12236389-12236411 CAGCCCGGTGTGCCAGCCCAGGG - Intergenic
1154954406 18:21241480-21241502 CAGCTGGACGCGGCTGCCCTGGG + Intergenic
1155340844 18:24812636-24812658 CAGCTGGGAGGCCCTCCCCTAGG - Intergenic
1156403721 18:36764025-36764047 CAGCTGTGTCTGTCTGCTCTTGG - Intronic
1156653300 18:39252593-39252615 AAGCTGAGTGTGTCTGCCCTTGG - Intergenic
1157002590 18:43544875-43544897 CAGCCAGGTGTTCCTGCCATTGG - Intergenic
1157580868 18:48773494-48773516 GAGCTGGGGTTGCCTGCCATGGG + Intronic
1157666797 18:49493981-49494003 CAGCTGGGAGTGGCAGCCCTGGG + Intergenic
1158890587 18:61868350-61868372 CAGCTGGGGGTGGCTGGGCTGGG - Intronic
1158901540 18:61966477-61966499 CAGGTGGGTGTTCCTGCTCATGG - Intergenic
1159161410 18:64647059-64647081 CAGCTGGGTGTGCACACACTTGG - Intergenic
1159320305 18:66839205-66839227 CTGGTGCTTGTGCCTGCCCTTGG + Intergenic
1159334288 18:67043682-67043704 CAGCCAGGTGTGCATGCACTTGG + Intergenic
1160560295 18:79751506-79751528 CGGCTGTGTGTGCCAGCCCACGG + Intronic
1161405884 19:4090888-4090910 CAGCGGCGTGTGCCAGGCCTGGG + Intronic
1161485194 19:4531724-4531746 CAGCAGCGGGTGCCTGTCCTTGG + Exonic
1161513885 19:4685801-4685823 CAGCTGGATGTGGCTTCCCCGGG - Intronic
1161698526 19:5783247-5783269 CCGCTCGCTGTGCCTGCCCGAGG - Exonic
1161743037 19:6036229-6036251 CTGCTGGGGCTGCCTGGCCTGGG + Intronic
1161943328 19:7419291-7419313 CACCTGGGTGTGCCCACACTTGG + Intronic
1162495664 19:11022049-11022071 CAGCTGGCTGGGCCTGTGCTGGG + Intronic
1163033977 19:14561183-14561205 TGGGTGGGTGGGCCTGCCCTGGG + Intronic
1163454565 19:17399008-17399030 CTGCTGAGTGTCCCTGCTCTGGG - Intergenic
1163692953 19:18746967-18746989 CAGCCGGGGCTTCCTGCCCTGGG + Intronic
1163809116 19:19419358-19419380 CAGGTGGCTGTTCCTGCCCATGG + Intronic
1166351684 19:42201792-42201814 CAGCTGGGTCTGAATGCCATGGG - Intronic
1166864366 19:45827065-45827087 GAGCAGTGTGTGGCTGCCCTGGG - Intronic
1166960104 19:46492085-46492107 CATCTGGGTGTCCCTGACATAGG + Exonic
1167484964 19:49757335-49757357 CAGCTGGGTGGGCCTGGCTCAGG - Intronic
1167498234 19:49831378-49831400 CAGCTGGGAGCCCCAGCCCTCGG + Exonic
1167547905 19:50140280-50140302 CGGCTGGATGCGCCTGCCCTCGG - Intergenic
1168682417 19:58325765-58325787 CAGCTGTGTTTGCCTGCACCAGG - Intergenic
925390355 2:3490124-3490146 TGCCTGGGGGTGCCTGCCCTGGG - Intergenic
925844716 2:8024816-8024838 CAGCTGGGTGAGGCAGCCCGTGG - Intergenic
927502903 2:23594075-23594097 AGGCTGGGTGTGGCAGCCCTTGG + Intronic
929575905 2:43051490-43051512 CAGCTGGGTGAGCCACCCATCGG + Intergenic
932327562 2:70873106-70873128 CACCTGAGAGTGCCTGCCCAGGG + Intergenic
934068832 2:88364951-88364973 CTGCTGGGTGTGCATGCCTACGG + Intergenic
934557102 2:95293297-95293319 ATGCTGGGTGTGCCCGTCCTGGG + Intergenic
935476308 2:103527944-103527966 CTTCTGGGTGGACCTGCCCTGGG - Intergenic
935492227 2:103735101-103735123 GAGCTGAGTATGCCTGTCCTTGG + Intergenic
936622023 2:114109788-114109810 CTGGTGCTTGTGCCTGCCCTTGG + Intergenic
938063356 2:128268570-128268592 CAGCTGGGCCCGCTTGCCCTCGG + Exonic
938254718 2:129847542-129847564 CAGCAGTCTGTGCCTGCCCAGGG - Intergenic
938770725 2:134498742-134498764 CAGCTGGCTCTGCCTGTCCCTGG - Intronic
939351219 2:141040530-141040552 CTGCTGTATGTGCCTGTCCTAGG + Intronic
945898529 2:215512657-215512679 TAGCTGGGCGTGCCTGTGCTGGG - Intergenic
947943060 2:234075690-234075712 CAGCTGGGTGTCAAAGCCCTGGG - Intronic
948148777 2:235728571-235728593 GAGCTGCTGGTGCCTGCCCTGGG + Intronic
948199777 2:236121164-236121186 CAGCTGGGTGTCCCACCTCTGGG - Intronic
948587267 2:239027273-239027295 CGGCTGGGAGTGCCGGCCCAGGG - Intergenic
948884214 2:240874880-240874902 CAGCTGTGTGACCCTGCCATGGG - Intronic
1168849000 20:963906-963928 CAGCCTCGTGTGCCTGTCCTGGG + Intronic
1169908034 20:10623274-10623296 CGGTTTGCTGTGCCTGCCCTGGG - Exonic
1170052061 20:12156835-12156857 CAGCTGGTTGAGTCTGCCATGGG + Intergenic
1170240772 20:14164343-14164365 GAGCTGAGTGTGCCTGTCCTTGG + Intronic
1171273268 20:23833080-23833102 CAGCTGGGAGTCACTGACCTGGG + Intergenic
1171285943 20:23938158-23938180 CAGCTGGGTGTTTGTGCACTTGG + Intergenic
1171492584 20:25531867-25531889 CAGCTGGGGGTGCCTGGCCTTGG + Intronic
1171989352 20:31684071-31684093 CAGCTGGCTGACTCTGCCCTGGG - Intronic
1172688892 20:36777312-36777334 CAGCTGGCTGTGGCCTCCCTGGG + Intergenic
1172777726 20:37417178-37417200 GAGCTGGGTGTGGCCTCCCTGGG - Intergenic
1174320836 20:49740290-49740312 CAGCTGGGTGTGGCAGCACAGGG - Intergenic
1174358354 20:50012975-50012997 CAGCCAGGTGGACCTGCCCTGGG + Intergenic
1175094721 20:56532292-56532314 CAGCAGTGTGTGCCTGCCTTGGG - Intergenic
1175191515 20:57215111-57215133 CAGCTGGGTGCCCATGGCCTGGG - Intronic
1175356604 20:58373894-58373916 CAGCTGGGTTTGTCTGTCTTTGG - Intergenic
1176112702 20:63417820-63417842 CAGCAGGGTGTGTCTGCCGCTGG - Intronic
1177624926 21:23646830-23646852 CGGCTCAGTGTGCATGCCCTTGG - Intergenic
1178617069 21:34143761-34143783 CAGCTGCCTGTGTCTGCACTGGG + Intergenic
1179502007 21:41815907-41815929 CCGCTGCCTGTGCCTGCCCCAGG - Intronic
1179881744 21:44295950-44295972 CTGCTGGGGGTGCCTGCCTGGGG + Intronic
1179953849 21:44727142-44727164 CAGATGGCTGTGCTGGCCCTTGG - Intergenic
1180072492 21:45443310-45443332 TGGCTGTGTGAGCCTGCCCTGGG + Intronic
1180487729 22:15817573-15817595 CAGCTGGGCTTGCCTGAGCTGGG + Intergenic
1180625219 22:17189801-17189823 CAGCAGCCTGAGCCTGCCCTGGG + Intronic
1180972482 22:19822680-19822702 CTGCTGGCTGTGGCTGCCGTGGG - Intronic
1181573763 22:23781466-23781488 CATCTGTCTGTTCCTGCCCTTGG - Intronic
1181743877 22:24942438-24942460 CAGAAGGGTGAGCCTGCCCAAGG + Intronic
1181943105 22:26494199-26494221 CAGATGGATGTGCCAGCACTTGG + Exonic
1182583254 22:31327944-31327966 CGGCTGGGTGTCCCCACCCTAGG + Intronic
1182585103 22:31340453-31340475 CAGCCAGGTGTGCCTGGACTTGG - Intronic
1183721930 22:39567717-39567739 GAGCTGGGCTGGCCTGCCCTTGG - Intergenic
1183758951 22:39798636-39798658 AAGCTGAGGGTGCCTGTCCTTGG + Intronic
1184094993 22:42311625-42311647 CAGCTGGGAGGGCCAGGCCTGGG - Intronic
1184118649 22:42436536-42436558 CAGGTGGGTCTGCCTGCCTCTGG - Intergenic
1184654590 22:45934709-45934731 CACCTGGCTATGCCTGCCCCAGG + Intronic
1184803032 22:46774120-46774142 CTGCTGGGCCTGCCTGCCCTTGG + Intronic
949217155 3:1583615-1583637 CAGCTGGTTGGGCCTGCTCCTGG + Intergenic
951372150 3:21862710-21862732 CAGCTAGCTGTGCCTCCCCAAGG + Intronic
951475767 3:23104082-23104104 CAGCTGGGGCTGCCTGGGCTTGG - Intergenic
951584156 3:24198081-24198103 CAGGTGGCTTTGCCTGGCCTGGG + Intronic
951611366 3:24495237-24495259 GAGCCGGGTTTGCCTGCTCTTGG - Intronic
953124527 3:40078188-40078210 CAGCTGGCCCTGCCGGCCCTGGG - Intronic
953191821 3:40694947-40694969 CAGCTGGGAGTTTCTTCCCTGGG - Intergenic
953829703 3:46285481-46285503 TAGCCGGATGTGCCTGGCCTGGG + Intergenic
953983887 3:47426867-47426889 CAGCTGGGGATGCCTGCCCTAGG + Intronic
954374706 3:50188119-50188141 CAGCTGCCTGTGCCTGCCATGGG + Exonic
954379528 3:50212311-50212333 CAGCTGGGGGTGCCCTCTCTCGG - Intronic
954396686 3:50296877-50296899 CAGCTGGGTGAGCCTGTGCAGGG - Exonic
954457824 3:50609542-50609564 CTGCTGGGTGGGCTTCCCCTAGG - Intronic
955110164 3:55941218-55941240 CAGTTGCGTGTACCTGCCATGGG + Intronic
956555129 3:70512976-70512998 CAGCTGGGTGGGCATCCTCTTGG + Intergenic
957459444 3:80497683-80497705 CAGCTGGGTGTGCATGCTCAGGG - Intergenic
960551303 3:118978536-118978558 GAGCTGACTGTGCCTGCCCTTGG - Intronic
960995841 3:123339543-123339565 CAACAGGGAGAGCCTGCCCTGGG + Intronic
961038444 3:123660037-123660059 CACCTGGATGTCCCTTCCCTGGG + Intronic
961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG + Intronic
962685897 3:137847480-137847502 CAGCAGGCTGTGCCTGCCCTGGG + Intergenic
965003516 3:162987456-162987478 CTGCTGGCCCTGCCTGCCCTGGG + Intergenic
966681133 3:182643248-182643270 CAACTTCATGTGCCTGCCCTTGG + Intergenic
967460960 3:189744862-189744884 GGGCTGAGTGTGCCTGTCCTTGG - Intronic
967557785 3:190878010-190878032 CGGCCGGTTGCGCCTGCCCTCGG - Intronic
968585252 4:1413361-1413383 CGGCTCAGTGTGTCTGCCCTTGG - Intergenic
968818735 4:2834842-2834864 CAGCTGGGTGTGCAGGGACTGGG + Exonic
968921168 4:3522878-3522900 TAGCCAGGTGTGCCTGCCCTTGG - Intronic
968980847 4:3848631-3848653 CAGCCAGGTGTGCCTACCCTGGG - Intergenic
969293061 4:6252876-6252898 CAGCTTGGTGTGCATGGCCAAGG - Intergenic
969370506 4:6728352-6728374 CAGCGGTGTGTGCCAGGCCTGGG - Intergenic
969573975 4:8025710-8025732 GAGCGGGGTGAGCCTGCCCTCGG + Intronic
969605758 4:8201541-8201563 CAGCTGGGTGAGCTGGCCCCTGG + Intronic
971714172 4:30153765-30153787 CAGCTGGGTGTGCACACACTAGG - Intergenic
972324040 4:37998463-37998485 CAGCTGGGTCGGGCTGTCCTGGG + Intronic
973026979 4:45284656-45284678 CGGCTGGGTGTGCATGCACTTGG - Intergenic
977926565 4:102706200-102706222 AGGCTGAGTGTGCCTGTCCTTGG - Intronic
978466243 4:109012576-109012598 CAGCCGGCGGTGCCAGCCCTGGG + Intronic
979865206 4:125745091-125745113 CGGCTGGTTCTGCCAGCCCTGGG + Intergenic
979956092 4:126955660-126955682 CAGCTGGGTGTGTGAGCGCTTGG + Intergenic
980738211 4:136917954-136917976 CAGCTGGGTGTGCATGCTCTTGG + Intergenic
981286012 4:143020022-143020044 CAGAGGGGTGTGACTGCTCTGGG + Intergenic
982088669 4:151861848-151861870 CAGCAGTGTGTTCCTGCCCCAGG + Intergenic
982724460 4:158890873-158890895 CAGCTGGATGCTCCTTCCCTGGG - Intronic
982901100 4:161003615-161003637 CAGCTGGGTGTGCACACGCTTGG - Intergenic
983268142 4:165529567-165529589 CATGTGTGTGTGCCTACCCTTGG - Intergenic
985578309 5:683892-683914 CAGCTGGGTGTGCTGCCGCTGGG + Intronic
985599547 5:819588-819610 CAGCCGGGAGTTCCTGGCCTTGG + Exonic
985691173 5:1313495-1313517 CACGTGGCTGTGCCTGCCTTTGG - Intergenic
986760933 5:10879006-10879028 CTGCTGTGTGGGCCTTCCCTTGG + Intergenic
986997578 5:13624917-13624939 CAGCTGACTTTGCATGCCCTTGG + Intergenic
987841154 5:23224179-23224201 TAGCTGGGGGTGACTGACCTGGG - Intergenic
987875356 5:23674612-23674634 CGGCTGGGTGTGCGCACCCTTGG + Intergenic
988037888 5:25851603-25851625 CAGCTCAGTGTGACAGCCCTCGG + Intergenic
988128428 5:27073316-27073338 CAGCTGGGAGGTCCTGCCCAGGG - Intronic
997381967 5:133444709-133444731 GAGCTGGATGGGCCTGTCCTTGG + Intronic
997940024 5:138148918-138148940 CAGCTGGGTGTGGTGGCCCATGG + Intronic
999375899 5:151086317-151086339 CAGCTGTGTCTGCCTGCCCTTGG + Intronic
999941933 5:156552368-156552390 CAGTTGGCAGTGCCTGACCTAGG + Intronic
1001166627 5:169374540-169374562 CGGCTTGGTGTGCCTGCTGTGGG - Intergenic
1002435597 5:179229028-179229050 CAGCTGGAGGTGCCTGACCGAGG - Intronic
1003562666 6:7195774-7195796 CACCTGGGTGTGGGTGTCCTGGG - Intronic
1006463861 6:34179342-34179364 CAGCTGGGTGTGCATGCACTTGG - Intergenic
1006811889 6:36825449-36825471 CAGTTGGGGGTGGCTGCCTTTGG - Intronic
1006922155 6:37634124-37634146 CAGCTGGGCTATCCTGCCCTTGG - Exonic
1007096099 6:39214225-39214247 CGGCTGTGGGAGCCTGCCCTGGG + Intronic
1007367317 6:41404005-41404027 TCGCTGGCTCTGCCTGCCCTTGG + Intergenic
1007419629 6:41711866-41711888 GAGCTGGGTGAGCCTGCCAAGGG - Intronic
1008230889 6:48984044-48984066 CAGCTGGCCCTGCCGGCCCTGGG + Intergenic
1010399456 6:75431682-75431704 CAGCTGGCTGTGCCTGGTGTGGG - Intronic
1012431687 6:99170832-99170854 CATCTGGGGGTGGCTGTCCTTGG - Intergenic
1015627884 6:135200478-135200500 CAGCTTGATGTGTCTGCCATTGG + Intronic
1018335589 6:162785458-162785480 GAACTGGGTGTGCAGGCCCTTGG - Intronic
1018387167 6:163315325-163315347 GTTCTGTGTGTGCCTGCCCTGGG + Exonic
1018752632 6:166821016-166821038 CACCTGCTTGTCCCTGCCCTTGG - Intronic
1019179775 6:170178910-170178932 CAGCTGGGTGGCCCTGTCCTGGG - Intergenic
1019328528 7:451647-451669 CAGCAGGGCGTGGCTGCCCCAGG + Intergenic
1019638802 7:2091307-2091329 TTGCTGGGTGTGCCTGCCTCCGG + Intronic
1019686304 7:2384003-2384025 CACCTGGGTGTGCGGGCTCTGGG + Intergenic
1019686400 7:2384391-2384413 CAGCAGGGAGCGCCTGCCCAAGG - Intergenic
1021452912 7:20798458-20798480 CCGCGGGGTGTGCGAGCCCTCGG - Intergenic
1022356879 7:29624144-29624166 CAGCTGAGTCAGCCTGCCCTCGG + Intergenic
1022469341 7:30672637-30672659 CAGCTGGGTCAGCCTACCCATGG - Intronic
1022571415 7:31457630-31457652 CAGCTGGGTATGTTTGACCTGGG + Intergenic
1023816111 7:43951249-43951271 CATGTGGTTGTGCCTGGCCTAGG - Intronic
1023956889 7:44893735-44893757 CAGCACGGGGTGCCTGGCCTGGG - Intergenic
1025813732 7:64891003-64891025 CAGATGGCTGTGCTTGGCCTGGG + Intronic
1026185416 7:68079288-68079310 CAGCTGAGTGTCGCTGCCCCAGG - Intergenic
1026466079 7:70655796-70655818 CAGCTGGGTGTGGCAGACCTGGG - Intronic
1026766061 7:73160583-73160605 CATCTGGGTGTGGCTGGACTAGG + Intergenic
1026786347 7:73303988-73304010 GGGCTAGGTGTGCCTGCCCCGGG + Exonic
1026911149 7:74092690-74092712 CAGCTGGGTGGGCTGGCCCTGGG + Intronic
1026986405 7:74557739-74557761 CAGCTGCGTGTCCCTCCCCGGGG - Intronic
1027042536 7:74970279-74970301 CATCTGGGTGTGGCTGGACTAGG + Intronic
1027081107 7:75232078-75232100 CATCTGGGTGTGGCTGGACTAGG - Intergenic
1028465667 7:91148678-91148700 CTCCTGGGTGTGCCTGACCATGG - Intronic
1030981174 7:116186589-116186611 CAGCCAGGTGTGCATGCACTTGG - Intergenic
1031158749 7:118141315-118141337 AAGATGGGTGTGCCTTCCCAGGG - Intergenic
1032441956 7:131948728-131948750 CAGCAGGGTGTGGCTGTGCTAGG + Intergenic
1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG + Intronic
1034470800 7:151253399-151253421 CAGCAGGGTGGGCCTTACCTTGG + Intronic
1035056535 7:156039939-156039961 CAGCCGGGTGTCCCAGGCCTCGG + Intergenic
1035962952 8:4157779-4157801 CAGCTGGGTGAACTTGCCCAGGG + Intronic
1037315048 8:17592707-17592729 TAGCTGGGGGGGCCTGCCATGGG - Intronic
1037485170 8:19340107-19340129 CAGCTGGAACTGCCAGCCCTAGG - Intronic
1039187642 8:34934850-34934872 CAGATGACTCTGCCTGCCCTTGG + Intergenic
1039411640 8:37359977-37359999 CAGCCAGGACTGCCTGCCCTAGG + Intergenic
1039785951 8:40834270-40834292 CAGTTGCATGTGCCTGCCCTTGG - Intronic
1039896798 8:41722485-41722507 CTGCTGCCTGTGCCTGCTCTGGG - Intronic
1042439728 8:68811215-68811237 CAGCTGGGTGTGCATGCACTTGG - Intronic
1043634232 8:82369672-82369694 CAGGAGGGTGTGCCCTCCCTGGG + Intergenic
1047285965 8:123487387-123487409 CAGCTTGGAATGCCTGCCCCAGG - Intergenic
1048832401 8:138489646-138489668 AGGCTGGGTGTGCAGGCCCTTGG - Intronic
1049015069 8:139914307-139914329 CACCTGGGTGTCCCTGCCTGCGG - Intronic
1049182171 8:141228522-141228544 CTGCGGGGAGTGCCTGCCCGAGG - Exonic
1049426149 8:142538716-142538738 CAGCTTGGTGTGGCTGCCTGAGG + Intronic
1049622336 8:143604314-143604336 CAACTGAGTCAGCCTGCCCTGGG + Exonic
1049800151 8:144513908-144513930 CAGGTGGGTGTGTGTGCTCTGGG - Exonic
1050127145 9:2368564-2368586 CAGCCTGGTGAGCCTACCCTTGG + Intergenic
1050483922 9:6114398-6114420 CAGCTGGGTGTGCACACGCTTGG + Intergenic
1050580497 9:7050077-7050099 GAGCTGGGTGTGCCGTCTCTGGG + Intronic
1052466865 9:28839998-28840020 CAGTTGGGTGTGCCTGCACTTGG - Intergenic
1053284800 9:36843262-36843284 CATCTAGGTCTACCTGCCCTGGG + Intronic
1056207510 9:84334662-84334684 CAACTGCCTTTGCCTGCCCTAGG + Intronic
1056931830 9:90883914-90883936 GAGCTGAGTATGCCTGTCCTTGG - Intronic
1057074797 9:92132828-92132850 CAGCTGGGTCAGCCTGACCCTGG - Intergenic
1057331700 9:94121035-94121057 CATGTGGGTGGGCCTGCCCGAGG + Intergenic
1057447761 9:95129876-95129898 CTGCTGGGTGTGCATCCCCTTGG + Intronic
1057858026 9:98617259-98617281 CAGCTGGGTCTGGCTTTCCTTGG - Intronic
1057960512 9:99451548-99451570 GAGCTATCTGTGCCTGCCCTTGG - Intergenic
1058971127 9:110083994-110084016 CAGCTGGGAGTTCCCGCCCTAGG - Intronic
1060219038 9:121754784-121754806 CAGCAGGCTGGGCCTGCCCAGGG - Intronic
1060299739 9:122368235-122368257 CAGCTGGGGGTGCTGGCCCATGG + Intergenic
1061357684 9:130118869-130118891 CAGCTGGGTGTGCCTGCCCTTGG - Intronic
1061724235 9:132572757-132572779 AGGCAGGGTGAGCCTGCCCTAGG - Exonic
1061806109 9:133138502-133138524 CAGCTGGGTGTGCCAGGCAGTGG + Intronic
1062010455 9:134264147-134264169 CAGCTGGGTCCGGCGGCCCTGGG + Intergenic
1062030977 9:134361899-134361921 CAGCAGTGTGTTCATGCCCTGGG + Intronic
1062031033 9:134362106-134362128 CTGCTGGCTCTGCCCGCCCTGGG + Intronic
1062077374 9:134598176-134598198 CAGGTGGCTCTGCCTGCCTTTGG + Intergenic
1062111621 9:134785169-134785191 CCGTTGGCTGTGGCTGCCCTAGG + Intronic
1062191470 9:135249936-135249958 CGGCTGGGAGCCCCTGCCCTGGG - Intergenic
1062205983 9:135337674-135337696 CAGCAGGATGTGCCCGCCCTGGG + Intergenic
1062443689 9:136584533-136584555 CAGCTGGGGGAGGCTGGCCTTGG + Intergenic
1062598998 9:137311721-137311743 CCACTGGCTGTGCCCGCCCTTGG + Intronic
1186751323 X:12623899-12623921 CAGGTGGGTGTCACTGCCCCTGG - Intronic
1187244698 X:17543518-17543540 CAGCTCCGTCTGCCTTCCCTGGG - Intronic
1187871307 X:23767168-23767190 CAGCTGGGTGTGCGTGCGCCTGG - Intergenic
1189738496 X:44095329-44095351 CAGCTGGGTGTGAGTGCTATTGG - Intergenic
1189896852 X:45665039-45665061 CAGCTGGCCCTGCCTGCCCCAGG - Intergenic
1192221077 X:69197735-69197757 CAGCTTGGGCTGCCTGGCCTGGG - Intergenic
1194140114 X:90198445-90198467 AATCTGGGTGTTCCTGCACTGGG - Intergenic
1199699347 X:150364493-150364515 CAGCTGGGTGCGGCTGACCTGGG + Intronic
1200152243 X:153956900-153956922 CGGCTGGGAGTGCCTCACCTGGG + Exonic
1200684492 Y:6246548-6246570 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1200990021 Y:9337807-9337829 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1200992683 Y:9358122-9358144 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1200995337 Y:9378401-9378423 CAGCAGGCTGTGCCTGGCCCTGG + Intronic
1200998001 Y:9398746-9398768 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1201000510 Y:9467280-9467302 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1201003178 Y:9487610-9487632 CAGCAGGCTGTGCCTGGCCCTGG + Exonic
1201005835 Y:9507892-9507914 CAGCAGGCTGTGCCTGGCCCTGG + Intergenic
1201008491 Y:9528205-9528227 CAGCAGGCTGTGCCTGGCCCTGG + Exonic